View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21683_high_38 (Length: 308)
Name: NF21683_high_38
Description: NF21683
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21683_high_38 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 20 - 308
Target Start/End: Complemental strand, 39076443 - 39076163
Alignment:
| Q |
20 |
gacatcatcattgcattgtctaaacatttacttgcactaatttgtatttaattgactaagtatatgcagctcaacaattatgcgaagaaaacactgaatg |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076443 |
gacatcatcattgcattgtctaaacatttacttgcactaatttgtttttaattgactaagtatatgcagctcaacaattatgcgaagaaaacactgaatg |
39076344 |
T |
 |
| Q |
120 |
aagacttatatagttaagcaattaatgtccatgcatttagcttgttaagacaaattcatatttgttcgtgcaatcgaaaaagctttttgttcaacctgca |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076343 |
aagacttatatagttaagcaattaatgtccatgcatttagcttgttaagacaaattcatatttgttcgtgcaatcgaaaaagctttttgttcaacctgca |
39076244 |
T |
 |
| Q |
220 |
cttgttttactttttcataaatgcnnnnnnnnnnnnnnnnnctgcggctgcaattggtcttagataaatgatgaaattgaaaatgatgg |
308 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39076243 |
cttgttttactttttcataaatgc--------aaaaaaaaactgcggctgcaattggtcttagataaatgatgaaattgaaaatgatgg |
39076163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University