View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21685_high_19 (Length: 339)
Name: NF21685_high_19
Description: NF21685
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21685_high_19 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 198 - 329
Target Start/End: Complemental strand, 26783054 - 26782921
Alignment:
| Q |
198 |
tccacctgacgaacccctgggaaattttaccattataatctaacttatatat--gagttttcttccctaaaaatatgggaatagaagaaaatttgcacct |
295 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26783054 |
tccacctgacgaacccctgggaaattataccattatcatctaacttatatatatgagttttcttccctaaaaatatgggaatagaagaaaatttgcacct |
26782955 |
T |
|
| Q |
296 |
gccttgtaagcttgaagcaattaagccatctgtg |
329 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
26782954 |
gccttgtaagcttgaagcaattaagccatctgtg |
26782921 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 1 - 74
Target Start/End: Complemental strand, 26783251 - 26783178
Alignment:
| Q |
1 |
tgagttattgatattccgactgcgttgacacctcaattacccaacaatcatatgctggacccctagatattatt |
74 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
26783251 |
tgagttattgatattccgactgcgttgacacctcaattacccaacaatcatatgcaggacccctagatattatt |
26783178 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University