View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21686_high_1 (Length: 365)
Name: NF21686_high_1
Description: NF21686
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21686_high_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 5 - 178
Target Start/End: Original strand, 4055098 - 4055271
Alignment:
| Q |
5 |
gagaagcagagaaacaaagatattactgttatgcccttcactctcaaagtcaaaaagtgttgaacttgttacttgtgatgatnnnnnnnttgatcttggt |
104 |
Q |
| |
|
||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4055098 |
gagaaacagagaaacaaagatatcactgttatgcccttcactctcaaagtcaaaaagtgttgaacttgttacttgtgatgatgaaaaaattgatcttggt |
4055197 |
T |
 |
| Q |
105 |
tccatagctatagcttttgggttagacccatcaacgttgaggttgaatggttactttataagtagaggagttga |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4055198 |
tccatagctatagcttttgggttagacccatcaacgttgaggttgaatggttactttataagtagaggagttga |
4055271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 231 - 311
Target Start/End: Original strand, 4055324 - 4055405
Alignment:
| Q |
231 |
agaggtttgtctactgggaaaagtaaccatgatgctattgttgttactggcaaagatgttaacaagggta-tgtttgtcaag |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4055324 |
agaggtttgtctactgggaaaagtaaccatgatgctattgttgttactggcaaagatgttaacaagggtattgtttgtcaag |
4055405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University