View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21687_high_19 (Length: 330)
Name: NF21687_high_19
Description: NF21687
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21687_high_19 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 22 - 330
Target Start/End: Original strand, 13982638 - 13982946
Alignment:
| Q |
22 |
catcatcatcatttttgccccataaatctctctctattctttttaccctaaaacacacaaacccatttcctacataaacctcttcatctttcatcactct |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13982638 |
catcatcatcatttttgccccataaatctctctctattctttttaccctaaaacacacaaacccatttcctacataaacctcttcatctttcatcactct |
13982737 |
T |
 |
| Q |
122 |
cacactctctttccatgttcaaccagtgccatttcaattttttcatctaaccacatcaataaagnnnnnnnnnnnnnnnnnnnnncaataaccccttttc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
13982738 |
cacactctctttccatgttcaaccagtgccatttcaattttttcatctaatcacatcaataaagttttgttttttaagcttttttcaataaccccttttc |
13982837 |
T |
 |
| Q |
222 |
atgaagtttcattattagcacccttttaatcaacctctctttcaatggctgaaagctttgacagtgctgaatctaatcttttatgtagtgaaaacaatag |
321 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13982838 |
atgaagtttcattattagcacccttttaatcaacctctctttcaatggctgaaagctttgacagtgctgaatctaatcttttatgtagtgaaaacaatag |
13982937 |
T |
 |
| Q |
322 |
cacatgttt |
330 |
Q |
| |
|
||||||||| |
|
|
| T |
13982938 |
cacatgttt |
13982946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University