View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21688_high_13 (Length: 329)
Name: NF21688_high_13
Description: NF21688
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21688_high_13 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 89; Significance: 7e-43; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 25 - 117
Target Start/End: Original strand, 33488703 - 33488795
Alignment:
| Q |
25 |
catcaactgaaaaataatcaaaatatacaagagactgcttaagtcaatattatataagtattttgtttgttttgataaaatatttgttaagaa |
117 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33488703 |
catcaaatgaaaaataatcaaaatatacaagagactgcttaagtcaatattatataagtattttgtttgttttgataaaatatttgttaagaa |
33488795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 206 - 253
Target Start/End: Original strand, 33488821 - 33488868
Alignment:
| Q |
206 |
ttgccacatgagattgttacaccatcatatagaagaaattcagctgtt |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33488821 |
ttgccacatgagattgttacaccatcatatagaagaaattcagctgtt |
33488868 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000004; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 205 - 253
Target Start/End: Complemental strand, 1611134 - 1611086
Alignment:
| Q |
205 |
tttgccacatgagattgttacaccatcatatagaagaaattcagctgtt |
253 |
Q |
| |
|
|||| ||| |||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
1611134 |
tttgacacctgagattgttacaccatccttgagaagaaattcagctgtt |
1611086 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 178 - 206
Target Start/End: Complemental strand, 1611179 - 1611151
Alignment:
| Q |
178 |
ttatcatagaagagagatgatgaatgatt |
206 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1611179 |
ttatcatagaagagagatgatgaatgatt |
1611151 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University