View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21689_high_3 (Length: 347)
Name: NF21689_high_3
Description: NF21689
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21689_high_3 |
 |  |
|
| [»] scaffold0725 (2 HSPs) |
 |  |  |
|
| [»] scaffold0014 (2 HSPs) |
 |  |  |
|
| [»] scaffold0039 (2 HSPs) |
 |  |  |
|
| [»] scaffold0250 (2 HSPs) |
 |  |  |
|
| [»] scaffold0095 (3 HSPs) |
 |  |  |
|
| [»] scaffold0136 (4 HSPs) |
 |  |  |
|
| [»] scaffold0176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0040 (2 HSPs) |
 |  |  |
|
| [»] scaffold0010 (2 HSPs) |
 |  |  |
|
| [»] scaffold0804 (1 HSPs) |
 |  |  |
|
| [»] scaffold0384 (2 HSPs) |
 |  |  |
|
| [»] scaffold0228 (3 HSPs) |
 |  |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |  |
|
| [»] scaffold0769 (2 HSPs) |
 |  |  |
|
| [»] scaffold0142 (1 HSPs) |
 |  |  |
|
| [»] scaffold0098 (2 HSPs) |
 |  |  |
|
| [»] scaffold0031 (2 HSPs) |
 |  |  |
|
| [»] scaffold0450 (2 HSPs) |
 |  |  |
|
| [»] scaffold0246 (1 HSPs) |
 |  |  |
|
| [»] scaffold0227 (2 HSPs) |
 |  |  |
|
| [»] scaffold0032 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0727 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (3 HSPs) |
 |  |  |
|
| [»] scaffold0079 (1 HSPs) |
 |  |  |
|
| [»] scaffold0809 (2 HSPs) |
 |  |  |
|
| [»] scaffold0192 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
| [»] scaffold1554 (1 HSPs) |
 |  |  |
|
| [»] scaffold0041 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
| [»] scaffold0933 (1 HSPs) |
 |  |  |
|
| [»] scaffold0632 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 98; Significance: 3e-48; HSPs: 171)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 122
Target Start/End: Original strand, 3601227 - 3601348
Alignment:
| Q |
1 |
tctgtcatatggggactatgattagatagggttgtctaaactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaa |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||| | |||||| |||||||||| |||||||||||||||||| |||||||||||||||| |
|
|
| T |
3601227 |
tctgtcatatggggactatgattagatagggttgtctaagctaactcgtgagcaacctcattcgcttgcctcctattgaactcgacatgagagttctgaa |
3601326 |
T |
 |
| Q |
101 |
atctattaactaataattgttt |
122 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
3601327 |
atctattaactaataattgttt |
3601348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 24546575 - 24546497
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
24546575 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcatcacctttttcagatgacgtggcgcgctgactgtat |
24546497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 123 - 314
Target Start/End: Original strand, 26095814 - 26096005
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnnttt-attcggtccttgtnnnnnnnttttgttt |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||||| |||||||| |
|
|
| T |
26095814 |
gggttaataggtctttaccccctgtaatataggtcacttatggttttgccccctgtaaaaaaaaattttttgattcggtccttgtaaaatttttttgttt |
26095913 |
T |
 |
| Q |
222 |
tagaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
| |||| |||||||||||||||||||||||||||||||||||||| ||||||||||||| | ||||||||||| |||||||||| |
|
|
| T |
26095914 |
t-gaaatacccccctagaccagctgactgtgcatttttgctgatgtggcatgcgccgtcacctttttcgggtgacgtggcgcgctgactgtat |
26096005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 240 - 314
Target Start/End: Complemental strand, 13903344 - 13903270
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
13903344 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttcggatgacgtggcgcgttgactgtat |
13903270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 31645346 - 31645424
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31645346 |
tagaccagctgactgtgcatttttgctgatgtgacatgctgcgtcaccttttttggatgacgtggcgcactgactgtat |
31645424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 32130757 - 32130835
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
32130757 |
tagaccagctgactgtgcatttttgctgatgtgacatgttgtgtcacctttttcggatgacgtggcgcactgacggtat |
32130835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 243 - 314
Target Start/End: Original strand, 22591400 - 22591471
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
22591400 |
gctgactgtgcatttttgctaatgtggcatgatgcgtcacctttttctgatgacgtggcgcgctgactgtat |
22591471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 24545570 - 24545648
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| ||||||||| |
|
|
| T |
24545570 |
tagaccagctgactgtgcatttttgctgatgtggcatgctgcgtcaccttttttggatgacgtggcgcgatgactgtat |
24545648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 47145263 - 47145341
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| | ||||||||| |
|
|
| T |
47145263 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcaccttttttggatgacgtggcacgttgactgtat |
47145341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 47146331 - 47146253
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||| ||||||| ||||| ||||||| |||||||||| |
|
|
| T |
47146331 |
tagaccagctgactgtgcatttttgctgatgtgacatgttgcgtcatctttttcggatgatgtggcgcgctgactgtat |
47146253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 48716435 - 48716513
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||| | ||||| ||||||| |||||||||| |
|
|
| T |
48716435 |
tagaccagctgactatgcatttttgctgatgtggcatgttgcgtcaccttttacggatgatgtggcgcgctgactgtat |
48716513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 125 - 314
Target Start/End: Original strand, 1825296 - 1825482
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnntttattcggtccttgtnnnnnnnttttgttttag |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||||||| | |
|
|
| T |
1825296 |
gttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt--aaatattttttttattcggtccttgtaaaaaaaatttgttttgg |
1825393 |
T |
 |
| Q |
225 |
aaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||| |||||||| ||| ||||||||||||||||||||||||| | | ||||||||||| |||||| |||||| ||||||||| |
|
|
| T |
1825394 |
aaaa-cccccctagaccagttgagtgtgcatttttgctgatgtggcatgcttcctcacctttttcggatgacatggcgcgatgactgtat |
1825482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 11 - 122
Target Start/End: Complemental strand, 2114451 - 2114340
Alignment:
| Q |
11 |
ggggactatgattagatagggttgtctaaactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctattaac |
110 |
Q |
| |
|
|||| ||| |||| ||||||| || |||| |||||| |||||||||| |||||| || | |||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
2114451 |
gggggctaggattggatagggctgcctaagctaattcgtgagcgaccccattcgcttccttcctgttgaactcgacatgagagttctgaaatctattaac |
2114352 |
T |
 |
| Q |
111 |
taataattgttt |
122 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
2114351 |
taataagtgttt |
2114340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 243 - 314
Target Start/End: Original strand, 28414858 - 28414929
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
28414858 |
gctgactgtgcatttttgctgatgtggcatgctgtgtcacctttttctgatgacgtggcacgctgactgtat |
28414929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 1826378 - 1826300
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |||||||||| | ||||| ||||||| |||||||||| |
|
|
| T |
1826378 |
tagaccagttgactgtgcatttttgctgatgtggcatgttgtgtcaccttttaccgatgatgtggcgcgctgactgtat |
1826300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 32131873 - 32131795
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||| |||||||||||||| |||||||||| || |||||||||| |
|
|
| T |
32131873 |
tagaccagctgactgtgcatttttgctgatttggcatgctgcgtcaccttttttggatgacgtggtgcgctgactgtat |
32131795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 241 - 314
Target Start/End: Complemental strand, 4415113 - 4415040
Alignment:
| Q |
241 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| || |||||||| |||||||||||||||||||||||| |
|
|
| T |
4415113 |
cagctgactgtgcatttttgctgatgtgacatgttgtgttaccttttttggatgacgtggcgcactgactgtat |
4415040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 14625370 - 14625425
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
14625370 |
gggttaataggtctttaccccctgtaatataggacacttttggttttgccccctgt |
14625425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 26097084 - 26097029
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26097084 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcctcctgt |
26097029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 243 - 314
Target Start/End: Complemental strand, 45833114 - 45833043
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
45833114 |
gctgactaggcatttttgctgatgtggcatgttgtgtcacctttttctgatgacgtgtcgcgctgactgtat |
45833043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 31648188 - 31648266
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||| || ||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
31648188 |
tagaccagctgactgtgcatttttactgatgtgacatgatgtgtcaccttttttggatgacgtggcgctctgactgtat |
31648266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 240 - 314
Target Start/End: Complemental strand, 44754542 - 44754468
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | || |||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
44754542 |
ccagctgactgtgcattttcgctgatgtggcacgctgagtcaccattttctgatgacgtggcgcgctgactgtat |
44754468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 51470126 - 51470184
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
51470126 |
tttgggttaataggtctttaccccctgtaatataagtcacttttggttttgccctctgt |
51470184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 43635835 - 43635888
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
43635835 |
gggttaataggtctttaccccctgtaatatagggcacttttggttttgccccct |
43635888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 241 - 314
Target Start/End: Complemental strand, 51471120 - 51471047
Alignment:
| Q |
241 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| || |||||||||||| |||||||||| || |||||||||| |
|
|
| T |
51471120 |
cagctgactctgcatttttgctgatgtggcatgctgtgtcacctttttcggatgacgtggtgcgctgactgtat |
51471047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 240 - 295
Target Start/End: Original strand, 4414028 - 4414083
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatga |
295 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
4414028 |
ccagctgactgtgcatttttgctaatgtggcatgttgcgtcacctttttcggatga |
4414083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 16785722 - 16785777
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16785722 |
gggttaataggcctttaccccctgtaatgtaggtcacttttggttttgccccctgt |
16785777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 32131960 - 32131909
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32131960 |
gggttaataggtctttaccccctgtaatataggtcactttcggttttgcccc |
32131909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 240 - 314
Target Start/End: Complemental strand, 16786092 - 16786018
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||| ||| ||||||||||| ||||| ||||||| |||||||||| |
|
|
| T |
16786092 |
ccagttgactgtgcatttttgctaatgtggcatgatgcatcacctttttcggatgaggtggcgcgctgactgtat |
16786018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 31677760 - 31677838
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||||| | || |||||||||||||||||||||||| | |||||||||| |
|
|
| T |
31677760 |
tagaccagctgactgtgtattttcactgatgtggcacgctgagtcacctttttctgatgacgtggcacgctgactgtat |
31677838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 240 - 314
Target Start/End: Complemental strand, 47221884 - 47221810
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| | || |||||| ||||||||||||||| ||| |||||||||| |
|
|
| T |
47221884 |
ccagctgactgtgcatttttgctgatgtagcacgctgggtcaccgttttctgatgacgtgacgcgctgactgtat |
47221810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 49200906 - 49200980
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | || |||||| ||||||||||||||||||| ||| |||||| |
|
|
| T |
49200906 |
ccagctgactgtgcattttcgctgatgtggcacgctgagtcaccgttttctgatgacgtggcgcgctggctgtat |
49200980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 123 - 172
Target Start/End: Complemental strand, 13903428 - 13903379
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcc |
172 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13903428 |
gggttaatagatctttaccccctgtaatataggtcacttttggttttgcc |
13903379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 249 - 314
Target Start/End: Original strand, 34932494 - 34932559
Alignment:
| Q |
249 |
tgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||| |||||||||||||| || |||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
34932494 |
tgtgcattttcgctgatgtggcatgctgagtcaccattttctgatgacgtggcgcgctgactgtat |
34932559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 240 - 313
Target Start/End: Complemental strand, 49201324 - 49201251
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgta |
313 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | || |||||| |||| |||||||||||||| ||||||||| |
|
|
| T |
49201324 |
ccagctgactgtgcattttcgctgatgtggcacgctgagtcaccgttttatgatgacgtggcgcgctgactgta |
49201251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 25601978 - 25601922
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
25601978 |
tttgggttaataggcctttaccccctgcaatataggtcacttttggttttcccccct |
25601922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 33667690 - 33667634
Alignment:
| Q |
123 |
gggttaataggtctttac-cccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33667690 |
gggttaataggcctttacacccctgtaatataggtcacttttggttttgccccctgt |
33667634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 114 - 178
Target Start/End: Complemental strand, 49201451 - 49201387
Alignment:
| Q |
114 |
taattgtttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||| |||||||||||||| ||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
49201451 |
taattttttgggttaataggcttttaccccctgcaatataggtcacttttggttttcccccctgt |
49201387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 8928815 - 8928870
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
8928815 |
gggttaataggtctttaccccctgtaatataaggcacttttgattttgccccctgt |
8928870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 243 - 314
Target Start/End: Original strand, 24962783 - 24962854
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||| ||||||||||||||| |||||| || |||| ||||| |
|
|
| T |
24962783 |
gctgactgtgcatttttgctcatgtggcatgatgcatcacctttttctgattacgtggtgcgctgattgtat |
24962854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 47146425 - 47146370
Alignment:
| Q |
124 |
ggttaataggtctttaccccct-gtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
47146425 |
ggttaataggtctttacccccttgtaatataggtcacttttggttttgctccctgt |
47146370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 388059 - 388133
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||| |||||| |||||||||| || |||||||| |||||||||||||||||| | |||||||||| |
|
|
| T |
388059 |
ccagctgactgtacattttcgctgatgtggtattttgcgtcatctttttctgatgacgtggtacgctgactgtat |
388133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 240 - 314
Target Start/End: Complemental strand, 6225307 - 6225233
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||| |||||||||||||||||| | || || ||||||||||||||| ||| ||| |||||||||| |
|
|
| T |
6225307 |
ccagctgactgtgtatttttgctgatgtggcacgctgagttacctttttctgatgatgtgacgccctgactgtat |
6225233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 13902066 - 13902120
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| || ||||||||||||||||||| |
|
|
| T |
13902066 |
ggttaataggtctttaccacctgtaatatagggcagttttggttttgccccctgt |
13902120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 241 - 307
Target Start/End: Original strand, 14978426 - 14978492
Alignment:
| Q |
241 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactg |
307 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||||||||||||| || ||| || ||||||| |
|
|
| T |
14978426 |
cagctgactatgcatttttgctgatgtggcatgttacgtcacctttttcggaggacatgacgcactg |
14978492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 15336372 - 15336426
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
15336372 |
tttggattaataggtctttaccccctgtaatataggtcatttttggtttttcccc |
15336426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 109 - 170
Target Start/End: Original strand, 20132367 - 20132429
Alignment:
| Q |
109 |
actaataattgtttgggttaataggtctttacccc-ctgtaatataggtcacttttggttttg |
170 |
Q |
| |
|
||||||| || |||||||||||||| ||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20132367 |
actaatatttttttgggttaataggcctttacccccctgtaatataggtcacttttggttttg |
20132429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 240 - 314
Target Start/End: Complemental strand, 25601857 - 25601783
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| | || |||||| ||||||||||||||||||| ||||| |||| |
|
|
| T |
25601857 |
ccagctgactgggcattttcgctgatgtggcacgctgagtcaccattttctgatgacgtggcgcgctgacagtat |
25601783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 33645011 - 33645065
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||| ||| ||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33645011 |
tttgggttattagatctttaccccctgtaatataggtcacttttgattttgcccc |
33645065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 47024611 - 47024685
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||| || ||||||| ||| || |||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
47024611 |
ccagctgactgtgcattttcgcagatgtggtatgctgagtcaccgttttctgatgacgtggcacgctgactgtat |
47024685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 121 - 178
Target Start/End: Original strand, 7112492 - 7112549
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| ||| |||||| |||||||| |
|
|
| T |
7112492 |
ttgggttaataggtctttaccccctgtaatatatgtcattttcggtttttccccctgt |
7112549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 241 - 314
Target Start/End: Original strand, 35978838 - 35978911
Alignment:
| Q |
241 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| || ||||| |||||| ||||||||| ||||| |||||||| |
|
|
| T |
35978838 |
cagctgactgtgcatttttgtagatgtggcatgctgtgtcacttttttcggatgacgtgtcgcacagactgtat |
35978911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 249 - 314
Target Start/End: Original strand, 50104664 - 50104729
Alignment:
| Q |
249 |
tgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||| ||| || ||||||||||||||||||| |||||| |||| ||||| |
|
|
| T |
50104664 |
tgtgcatttttgctgatgtggtatgctgtgtcacctttttctgatgacatggcgcgctgaatgtat |
50104729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 9441567 - 9441623
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| |||||||||| | |||||||||||||||||||||| |
|
|
| T |
9441567 |
gggttaataggtctttacccccctgtaatataagacacttttggttttgccccctgt |
9441623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 14626836 - 14626780
Alignment:
| Q |
123 |
gggttaataggtctttac-cccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
14626836 |
gggttaataggtctttactcccctgtaatatagggcacttttggttttgcctcctgt |
14626780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 49 - 101
Target Start/End: Complemental strand, 20639647 - 20639595
Alignment:
| Q |
49 |
tgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaa |
101 |
Q |
| |
|
|||| ||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
20639647 |
tgagtgacctcattggcttgcctcctattgaactcaacatgagagttctgaaa |
20639595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 23322667 - 23322611
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
23322667 |
gggttaataggtctttacccccctgtaatatagagcacttttggttttgccccctgt |
23322611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 25600930 - 25600986
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||||||||||| |||||||| |
|
|
| T |
25600930 |
gggttaataggtctttacccctctgcaatataggtcacttttggttttcccccctgt |
25600986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 246 - 314
Target Start/End: Original strand, 26943622 - 26943690
Alignment:
| Q |
246 |
gactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||| |||||||||||| |||| |||| | |||||||||||||||| || |||||||||| |
|
|
| T |
26943622 |
gactgtgcattttcgctgatgtggcacgttgagtcaacgttttctgatgacgtggtgcgctgactgtat |
26943690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 242 - 314
Target Start/End: Complemental strand, 48717254 - 48717182
Alignment:
| Q |
242 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| || ||||| ||||| ||||||||||| | |||||||||| |
|
|
| T |
48717254 |
agctgactgtacatttttgctgatgtggcatgatgtgtcacattttttggatgacgtggcacgctgactgtat |
48717182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 10028034 - 10027979
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||| ||| |||| |
|
|
| T |
10028034 |
gggttaataggtctttaccccctgtaatataggtcatttctggttttcccctctgt |
10027979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 14978766 - 14978715
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
14978766 |
gggttaataggcctttaccccctgttatataggacacttttggttttgcccc |
14978715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 239 - 308
Target Start/End: Complemental strand, 31648528 - 31648462
Alignment:
| Q |
239 |
accagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactga |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||| |||| |
|
|
| T |
31648528 |
accagctgactgtgcatttttgctgatgtggca---tgcgtcaccttttctggatgacgtggcgcgctga |
31648462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 35979641 - 35979590
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||||| ||||||||| |
|
|
| T |
35979641 |
gggttaataggtcttttccccctgtaatataagtcacttttgattttgcccc |
35979590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 39 - 101
Target Start/End: Original strand, 2536526 - 2536588
Alignment:
| Q |
39 |
aactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaa |
101 |
Q |
| |
|
|||||||| ||||||||| |||| | |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2536526 |
aactaattcatgagcgaccccattggcttgcctcctattgaactcgacatgagagttctgaaa |
2536588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 22591280 - 22591326
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
22591280 |
gggttaataggcctttaccccttgtaatataggtcacttttggtttt |
22591326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 123 - 177
Target Start/End: Original strand, 24545457 - 24545511
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctg |
177 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||| |||| |
|
|
| T |
24545457 |
gggttaataggcttttaccccctataatataggtcacttttggttttgcctcctg |
24545511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 121 - 178
Target Start/End: Original strand, 31648073 - 31648131
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
31648073 |
ttgggttaataggcctttacccccatgtaatataggtcacttttggttttatcccctgt |
31648131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 48 - 122
Target Start/End: Original strand, 32544394 - 32544468
Alignment:
| Q |
48 |
gtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctattaactaataattgttt |
122 |
Q |
| |
|
|||| |||||||||||| |||||| || || ||||| |||||| |||||||| |||||||||||||||| ||||| |
|
|
| T |
32544394 |
gtgaacgacctcattcgcttgccttctgttaaactcgacatgaaagttctgatatctattaactaataactgttt |
32544468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 46136083 - 46136137
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |||| ||||| |||| |
|
|
| T |
46136083 |
tttgggttaataagtctttaccccctgtaatataggtcattttttgttttccccc |
46136137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 47221995 - 47221949
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
47221995 |
gggttaataggtctttacctcctgcaatataggtcacttttggtttt |
47221949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 51470242 - 51470319
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||| |||| ||||||||||||||||||| |||| | ||||| ||||||| ||||||||||||| |||||||||| |
|
|
| T |
51470242 |
tagaccaattgaccgtgcatttttgctgatgtgacatgctacgtca-ctttttcggatgacgtggcgcgctgactgtat |
51470319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 120 - 173
Target Start/End: Original strand, 52083577 - 52083631
Alignment:
| Q |
120 |
tttgggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccc |
173 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| || |||||||||||||| |
|
|
| T |
52083577 |
tttgggttaataggtctttacccccctgtaatatagggcatttttggttttgccc |
52083631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 253 - 314
Target Start/End: Original strand, 33645139 - 33645199
Alignment:
| Q |
253 |
catttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||| || ||||| |||||| ||||||||||||| |||||||||| |
|
|
| T |
33645139 |
catttttgctgatgtggcatgctgtgtcacttttttc-gatgacgtggcgcgctgactgtat |
33645199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 126 - 178
Target Start/End: Complemental strand, 40247435 - 40247382
Alignment:
| Q |
126 |
ttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||||||||||| |||||||| |
|
|
| T |
40247435 |
ttaataggtctttacccccatgtaatatagggcacttttggttttcccccctgt |
40247382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 1826492 - 1826436
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||| || ||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
1826492 |
gggttaatatgtttttacccccctgtaatataggtcacttttgattttgccccctgt |
1826436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 118 - 158
Target Start/End: Original strand, 5348158 - 5348198
Alignment:
| Q |
118 |
tgtttgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
5348158 |
tgtttgggttaataggtctttaccctctgtaatataggtca |
5348198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 9443047 - 9442995
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||| |
|
|
| T |
9443047 |
gggttaataggtctttacccccctgtaatatagagcacttttggttttgcccc |
9442995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 49 - 101
Target Start/End: Original strand, 11351651 - 11351703
Alignment:
| Q |
49 |
tgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaa |
101 |
Q |
| |
|
||||||||| |||| | |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11351651 |
tgagcgaccccattggcttgcctcctattgaactcgacatgagagttctgaaa |
11351703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 125 - 169
Target Start/End: Original strand, 21853418 - 21853462
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
21853418 |
gttaataggtctttaccccctgtaatataggtcatttctggtttt |
21853462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 32130644 - 32130700
Alignment:
| Q |
123 |
gggttaataggtctttaccccct-gtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||||||||| || ||||| |
|
|
| T |
32130644 |
gggttaataggcctttaccccctagtaatataggtcacttttggttttaccacctgt |
32130700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 33934637 - 33934693
Alignment:
| Q |
123 |
gggttaataggtctttac-cccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33934637 |
gggttaatagggttttacgcccctgtaatatagatcacttttggttttgccccctgt |
33934693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 36343154 - 36343210
Alignment:
| Q |
123 |
gggttaataggtctttaccc-cctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |||| ||||| |||||||| |
|
|
| T |
36343154 |
gggttaataggtctttaccctcctgtaatataggtcattttttgttttcccccctgt |
36343210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 44754660 - 44754604
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||||||| || |||||||||||||||||||||| |||||||| |
|
|
| T |
44754660 |
gggttaataggcctttacccccctgcaatataggtcacttttggttttcccccctgt |
44754604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 242 - 310
Target Start/End: Original strand, 47221030 - 47221098
Alignment:
| Q |
242 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgact |
310 |
Q |
| |
|
|||| |||||||||||| |||||||| ||| ||| |||||| ||||||||||||||||||| |||||| |
|
|
| T |
47221030 |
agctaactgtgcattttcgctgatgtcgcacattgagtcaccgttttctgatgacgtggcgcgctgact |
47221098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 125 - 168
Target Start/End: Original strand, 2273503 - 2273546
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggttt |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
2273503 |
gttaataggtctttaccccctgtaatatagggcactttttgttt |
2273546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 4646757 - 4646812
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||| |||||||||| ||| |||| |
|
|
| T |
4646757 |
gggttaataggtctttaccccctctaatataagtcatttttggttttcccctctgt |
4646812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 7780277 - 7780223
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||| | ||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
7780277 |
gggttaatatgcctttacccc-tgtaatatagatcacttttggttttgccccctgt |
7780223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 13545579 - 13545634
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| || |||||| |||||||| |
|
|
| T |
13545579 |
gggttaataggtctttaccccctgtaatatatgtcatttccggtttttccccctgt |
13545634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 7 - 106
Target Start/End: Complemental strand, 17321974 - 17321875
Alignment:
| Q |
7 |
atatggggactatgattagatagggttgtctaaactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctat |
106 |
Q |
| |
|
|||||||| ||| |||||||||||| || | | |||| | |||||| ||| ||| | ||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
17321974 |
atatgggggctaggattagatagggctgcttgagctaactcgtgagctaccctatttgcttgcctcctgttgaactcgacatgagagttctgaaatctat |
17321875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 18458859 - 18458824
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
18458859 |
gggttaataggtctttaccccctgtaatataggtca |
18458824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 243 - 310
Target Start/End: Complemental strand, 22592269 - 22592202
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgact |
310 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||| ||||||| ||||| |||| || |||| |||||| |
|
|
| T |
22592269 |
gctgactatgcatttttgcttatgtggcatgttgtgtcacctctttctaatgatgtagcgcgctgact |
22592202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 24987608 - 24987643
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
24987608 |
gggttaataggtctttaccccctgtaatataggtca |
24987643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 25235774 - 25235809
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
25235774 |
gggttaataggtctttaccccctgtaatataggtca |
25235809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 236 - 299
Target Start/End: Complemental strand, 33645909 - 33645846
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtg |
299 |
Q |
| |
|
|||||||||||||| || |||||| ||||||||||||| || |||||||||||| || |||||| |
|
|
| T |
33645909 |
tagaccagctgactatgtatttttactgatgtggcatgctgggtcacctttttcagacgacgtg |
33645846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 236 - 308
Target Start/End: Complemental strand, 35979527 - 35979459
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactga |
308 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| ||||||| |||||| || |||||||||| |||| |
|
|
| T |
35979527 |
tagaccagctgactgtgcatttttgctgatttggca----gcgtcacttttttcggacgacgtggcgcgctga |
35979459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 44200327 - 44200382
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||||||||| | |||||| |
|
|
| T |
44200327 |
gggttaataggtctttaccccttgtaatataggccatttttggttttccaccctgt |
44200382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 127 - 178
Target Start/End: Original strand, 44753302 - 44753353
Alignment:
| Q |
127 |
taataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||| ||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
44753302 |
taataggcttttaccccctgcaatataggtcacttttggttttcccccctgt |
44753353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 44826368 - 44826313
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||| || ||||||| |||||||| |
|
|
| T |
44826368 |
gggttaataggtctttaccccctgtaatacatgtcatttatggttttcccccctgt |
44826313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 47022126 - 47022091
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
47022126 |
gggttaataggtctttaccccctgtaatataggtca |
47022091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 50105454 - 50105407
Alignment:
| Q |
123 |
gggttaataggtctttaccc-cctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
50105454 |
gggttaataggtctttaccctcctgtaatataggtcacttttgatttt |
50105407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 52084885 - 52084827
Alignment:
| Q |
122 |
tgggttaataggtctttaccccc--tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||| ||||||| |
|
|
| T |
52084885 |
tgggttaataggtctttaccccccctgtaatatagagcacttttggttttgtcccctgt |
52084827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 2472390 - 2472436
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| || ||||||| |
|
|
| T |
2472390 |
gggttaataggtctttaacccctgtaatataggtcatttctggtttt |
2472436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 124 - 174
Target Start/End: Complemental strand, 6225422 - 6225372
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||| |||| |||||||||||||||||||||| |||| |
|
|
| T |
6225422 |
ggttaataggtctttacttcctgcaatataggtcacttttggttttccccc |
6225372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 101
Target Start/End: Complemental strand, 6784333 - 6784283
Alignment:
| Q |
51 |
agcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaa |
101 |
Q |
| |
|
||||||| |||| | |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
6784333 |
agcgaccccattggcttgcctcctattgaactcgacatgagagttctgaaa |
6784283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 140 - 178
Target Start/End: Complemental strand, 24730243 - 24730205
Alignment:
| Q |
140 |
ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24730243 |
ccccctgtaatataggtcacttttggttttcccccctgt |
24730205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 236 - 270
Target Start/End: Complemental strand, 26096973 - 26096939
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggc |
270 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
26096973 |
tagaccagctgactgtgcatttttgctgatgtggc |
26096939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 28724325 - 28724371
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||| || ||||||| |
|
|
| T |
28724325 |
gggttaataggtctttaccccctgtaaaataggtcatttctggtttt |
28724371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 30434280 - 30434326
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
30434280 |
gggttaatcggtctttaccccctgtaatataggtcattttttgtttt |
30434326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 31648642 - 31648588
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||| |||||||||||||||||||||| | ||||||||||| ||||||| |
|
|
| T |
31648642 |
ggttaatagacctttaccccctgtaatataggttatttttggttttgtcccctgt |
31648588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 31837814 - 31837892
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||| |||||||||||| |||||| ||||||||||||| ||||| | ||||||| ||||||| | | | |||||||||| |
|
|
| T |
31837814 |
tagatcagctgactgtgtatttttactgatgtggcatgctgcgtaatctttttcggatgacgcgacacgctgactgtat |
31837892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 35168065 - 35168019
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| |||||||||| |
|
|
| T |
35168065 |
gggttaatagtgctttaccccctgtaatataggtcatttttggtttt |
35168019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 44311208 - 44311254
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||| |||| |
|
|
| T |
44311208 |
gggttaataggcctttaccccctgtaatataggacacttttgctttt |
44311254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 44826078 - 44826136
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||| ||| |||||| ||||||| |
|
|
| T |
44826078 |
tttgggttaataagtctttaccccctgtaatagaggtcattttcggttttctcccctgt |
44826136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 49 - 107
Target Start/End: Original strand, 44839911 - 44839969
Alignment:
| Q |
49 |
tgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctatt |
107 |
Q |
| |
|
||||||||| |||| |||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
44839911 |
tgagcgaccccattaacttgcctcctattgaactcgacatgagagttctgaaaactatt |
44839969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 124 - 174
Target Start/End: Original strand, 50104540 - 50104590
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||| |||||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
50104540 |
ggttaataggcctttacgccctgtaacataggtcacttttggttttccccc |
50104590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 124 - 169
Target Start/End: Complemental strand, 7112777 - 7112732
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| || ||||||| |
|
|
| T |
7112777 |
ggttaataggtctttaccccctgtaatatatgtcatttctggtttt |
7112732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 123 - 156
Target Start/End: Complemental strand, 9439459 - 9439426
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9439459 |
gggttaataggtctttaccccctgtaatataggt |
9439426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 250 - 303
Target Start/End: Complemental strand, 24962927 - 24962874
Alignment:
| Q |
250 |
gtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgc |
303 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||| |||| | ||||||| |
|
|
| T |
24962927 |
gtgcatttttgctgatgtcgcatgatgcgtcacctttttttgattatgtggcgc |
24962874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 121 - 158
Target Start/End: Complemental strand, 35034354 - 35034317
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
35034354 |
ttgggttaataggtctttatcccctgtaatataggtca |
35034317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 35384516 - 35384467
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||| |||||||||| |
|
|
| T |
35384516 |
tttgggttaatggtgctttaccccctgtaatataggtcatttttggtttt |
35384467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 121 - 158
Target Start/End: Complemental strand, 42736880 - 42736843
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42736880 |
ttgggttaataggtctttatcccctgtaatataggtca |
42736843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 121 - 178
Target Start/End: Complemental strand, 44312189 - 44312132
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||| ||||| |||||||||||| |||||||| ||| || ||||||||||||||| |
|
|
| T |
44312189 |
ttgggtttataggcctttaccccctgaaatatagggcacattcggttttgccccctgt |
44312132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 113 - 178
Target Start/End: Original strand, 51809746 - 51809811
Alignment:
| Q |
113 |
ataattgtttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||| ||||||||||| | ||||||||||||||||||||| | |||||||||| |||||||| |
|
|
| T |
51809746 |
ataattttttgggttaatggtgttttaccccctgtaatataggttatttttggtttttccccctgt |
51809811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 126 - 158
Target Start/End: Complemental strand, 2059480 - 2059448
Alignment:
| Q |
126 |
ttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2059480 |
ttaataggtctttaccccctgtaatataggtca |
2059448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 124 - 156
Target Start/End: Complemental strand, 2472640 - 2472608
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggt |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2472640 |
ggttaataggtctttaccccctgtaatataggt |
2472608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 242 - 314
Target Start/End: Complemental strand, 7780191 - 7780119
Alignment:
| Q |
242 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||| || ||||| | ||||||||||||||| |||| ||||| ||||||||||||| |||||||||| |
|
|
| T |
7780191 |
agctgactctgtattttcgtagatgtggcatgttgcatcactttttttggatgacgtggcgcgctgactgtat |
7780119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 66 - 106
Target Start/End: Complemental strand, 12539156 - 12539116
Alignment:
| Q |
66 |
ttgcctcctattgaactcaacatgagagttctgaaatctat |
106 |
Q |
| |
|
||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
12539156 |
ttgcctcctgttgaactcgacatgagagttctgaaatctat |
12539116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 236 - 308
Target Start/End: Original strand, 13902173 - 13902245
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactga |
308 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||| || ||||| |||| |||||||||||| |||| |
|
|
| T |
13902173 |
tagaccagctgactgtgcatctttgttgatgtggcatgctgtgtcacaatttttgaatgacgtggcgcgctga |
13902245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 16699162 - 16699110
Alignment:
| Q |
123 |
gggttaataggtctttaccccct-gtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| || ||||||| |||| |
|
|
| T |
16699162 |
gggttaataggtctttaccccctggtaatataggtcatttctggtttttcccc |
16699110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 18458566 - 18458622
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||| ||||| |||| || ||||| |
|
|
| T |
18458566 |
tgggttaagaggtctttaccccctgtaatatatgtcatttttgattttccctcctgt |
18458622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 23321263 - 23321315
Alignment:
| Q |
123 |
gggttaataggtctttaccc-cctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||| |||||| || ||||||||||||| |||||||||||||||||| |
|
|
| T |
23321263 |
gggttaatagatctttatcctcctgtaatatagggcacttttggttttgcccc |
23321315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 126 - 174
Target Start/End: Original strand, 49200795 - 49200843
Alignment:
| Q |
126 |
ttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
49200795 |
ttaataggcttttaccccctgcaatataggtcacttttggttttccccc |
49200843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 16786205 - 16786150
Alignment:
| Q |
124 |
ggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||||||||| |||| |||||||| |
|
|
| T |
16786205 |
ggttaatagagctttacccccatgtaatataggtcacttttgattttaccccctgt |
16786150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 22604719 - 22604684
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22604719 |
gggttaataggtctttaacccctgtaatataggtca |
22604684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 28410914 - 28410949
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28410914 |
gggttaataggtctttatcccctgtaatataggtca |
28410949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 28724587 - 28724532
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||| ||| |||||| | |||||| |
|
|
| T |
28724587 |
gggttaataggtctttaccccctctaatatatgtcattttcggttttccaccctgt |
28724532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 30659465 - 30659430
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30659465 |
gggttaataggtctttaccccctgtaatatatgtca |
30659430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 162
Target Start/End: Complemental strand, 33936134 - 33936095
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttt |
162 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
33936134 |
gggttaataggattttaccccctgtaatataggtcacttt |
33936095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 38742438 - 38742387
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
38742438 |
gggttaatagagctttaccccctgtaatatagggtacttttgattttgcccc |
38742387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 122 - 169
Target Start/End: Complemental strand, 39160590 - 39160543
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||| |||||||||| |
|
|
| T |
39160590 |
tgggttaatggtgctttaccccctgtaatataggtcatttttggtttt |
39160543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 40246394 - 40246469
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacct-ttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||| ||||||||||||||||| |||||| || |||| ||||| | |||||||||||||||| || |||| ||||| |
|
|
| T |
40246394 |
ccagttgactgtgcatttttgcagatgtgacacgttgagtcacatattttctgatgacgtggtgcgctgattgtat |
40246469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 122 - 169
Target Start/End: Complemental strand, 50596216 - 50596169
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| | || ||||||| |
|
|
| T |
50596216 |
tgggttaataggtctttaccccttgtaatataggttatttctggtttt |
50596169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 136 - 178
Target Start/End: Original strand, 12277201 - 12277243
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||| |||||||| |
|
|
| T |
12277201 |
tttacctcctgtaatataggtcatttttggttttcccccctgt |
12277243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 140 - 178
Target Start/End: Complemental strand, 15961781 - 15961743
Alignment:
| Q |
140 |
ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
15961781 |
ccccctgtaatataggtcatttttggttttcccccctgt |
15961743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 251 - 285
Target Start/End: Original strand, 20132509 - 20132543
Alignment:
| Q |
251 |
tgcatttttgctgatgtggcatgttgcgtcacctt |
285 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
20132509 |
tgcatttttgctgatgtggcatgctgcgtcacctt |
20132543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 20 - 106
Target Start/End: Complemental strand, 27877787 - 27877701
Alignment:
| Q |
20 |
gattagatagggttgtctaaactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctat |
106 |
Q |
| |
|
||||||| ||||||| || | |||| | |||||| ||| ||| | ||||||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
27877787 |
gattagacagggttgcctgagctaactcgtgagctaccctatttgcttgcctcctgctgaactcaacatgagagttatgaaatctat |
27877701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 236 - 270
Target Start/End: Complemental strand, 33667567 - 33667533
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggc |
270 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |
|
|
| T |
33667567 |
tagaccagttgactgtgcatttttgctgatgtggc |
33667533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 247 - 301
Target Start/End: Complemental strand, 34933298 - 34933244
Alignment:
| Q |
247 |
actgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggc |
301 |
Q |
| |
|
||||||||||||||||||| ||||||| || |||||| |||||||| ||||||| |
|
|
| T |
34933298 |
actgtgcatttttgctgatatggcatgctgagtcaccattttctgacaacgtggc |
34933244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 136 - 174
Target Start/End: Complemental strand, 34933378 - 34933340
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
34933378 |
tttaccccctgcaatataggtcacttttggttttccccc |
34933340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 136 - 178
Target Start/End: Original strand, 35978727 - 35978769
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
35978727 |
tttaccccctataatatatgtcacttttggttttgccctctgt |
35978769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 136 - 178
Target Start/End: Original strand, 38741488 - 38741530
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||| ||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
38741488 |
tttaacccctgtaatataagacacttttggttttgccccctgt |
38741530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 47021837 - 47021883
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||| || ||||||| |
|
|
| T |
47021837 |
gggttaataggtctttaccccccgtaatataagtcatttctggtttt |
47021883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 140 - 178
Target Start/End: Complemental strand, 50721966 - 50721928
Alignment:
| Q |
140 |
ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
50721966 |
ccccctgtaatataggtcatttttggttttcccccctgt |
50721928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 136 - 169
Target Start/End: Original strand, 972854 - 972887
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
972854 |
tttaccccctgtaatataggtcatttttggtttt |
972887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 123 - 172
Target Start/End: Complemental strand, 4415218 - 4415169
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcc |
172 |
Q |
| |
|
|||||| |||| || |||||| |||||||||| ||||||||||||||||| |
|
|
| T |
4415218 |
gggttagtaggcctctaccccttgtaatatagttcacttttggttttgcc |
4415169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 126 - 174
Target Start/End: Original strand, 5560876 - 5560925
Alignment:
| Q |
126 |
ttaataggtctttacccc-ctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
5560876 |
ttaataggtctttacccccctgtaatatagagcacttttggttttccccc |
5560925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 121 - 178
Target Start/End: Complemental strand, 13917329 - 13917272
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||| ||||||||||||| ||||||| |
|
|
| T |
13917329 |
ttgggttaatagagttttatcccctgtaatataggacacttttggttttctcccctgt |
13917272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 314
Target Start/End: Complemental strand, 26944328 - 26944256
Alignment:
| Q |
241 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||| || || |||||| ||||| | || ||||||||||||||||||| ||| || |||||||||| |
|
|
| T |
26944328 |
cagctgactgtgtatgttcgctgat-tggcacgctgagtcacctttttctgatgacatggagcgctgactgtat |
26944256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 27549014 - 27548958
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaa--tataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||| |||||||||||||||| ||||| |
|
|
| T |
27549014 |
ggttaataggcctttaccccctgtaatatatagtgcacttttggttttgccgcctgt |
27548958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 37194546 - 37194493
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
|||||||||| |||||| |||||||||||||| || |||||||||| |||||| |
|
|
| T |
37194546 |
gggttaatagaactttactccctgtaatataggacatttttggtttttccccct |
37194493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 123 - 171
Target Start/End: Original strand, 47145146 - 47145195
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgc |
171 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
47145146 |
gggttaatagacctttacccccctgtaatataggtcacttttgattttgc |
47145195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 106
Target Start/End: Original strand, 51080726 - 51080783
Alignment:
| Q |
49 |
tgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctat |
106 |
Q |
| |
|
||||||||| |||| | |||||||||||| ||||| ||||||||||| ||||| |||| |
|
|
| T |
51080726 |
tgagcgaccccattagattgcctcctattaaactcgacatgagagttttgaaaactat |
51080783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 135 - 168
Target Start/End: Original strand, 52413133 - 52413166
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttt |
168 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
52413133 |
ctttaccccctgtaatataggtcatttttggttt |
52413166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 118 - 158
Target Start/End: Original strand, 5330415 - 5330455
Alignment:
| Q |
118 |
tgtttgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
5330415 |
tgtttgggttaataggtttttaccctatgtaatataggtca |
5330455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 125 - 157
Target Start/End: Complemental strand, 21854054 - 21854022
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtc |
157 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
21854054 |
gttaataggtctttaccccttgtaatataggtc |
21854022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 129 - 169
Target Start/End: Complemental strand, 29018647 - 29018607
Alignment:
| Q |
129 |
ataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||| |||||| |
|
|
| T |
29018647 |
ataggtctttaccccctgtaatataagtcattttcggtttt |
29018607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 121 - 178
Target Start/End: Complemental strand, 31955549 - 31955490
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccc--tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||||||| ||| |||||| ||| |||| |
|
|
| T |
31955549 |
ttggggtaataggtctttaccccccctgtaatataggtcattttcggtttttccctctgt |
31955490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 34360302 - 34360266
Alignment:
| Q |
123 |
gggttaataggtctttacc-ccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
34360302 |
gggttaataggtctttacctccctgtaatataggtca |
34360266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 122 - 174
Target Start/End: Complemental strand, 37847829 - 37847777
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||| |||| ||||| |||| |
|
|
| T |
37847829 |
tgggttaatggtgctttaccccctgtaatataggtcattttttgttttccccc |
37847777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 121 - 169
Target Start/End: Original strand, 45832160 - 45832207
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||| |||| ||| |||||||||| |||||||||||||| |
|
|
| T |
45832160 |
ttgggttaataggtatttatccc-tgtaatatagatcacttttggtttt |
45832207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0725 (Bit Score: 82; Significance: 1e-38; HSPs: 2)
Name: scaffold0725
Description:
Target: scaffold0725; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 123 - 314
Target Start/End: Original strand, 3914 - 4105
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnnttt-attcggtccttgtnnnnnnnttttgttt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |||||||||||||||||||||| ||| ||||||||||||| |||||||| |
|
|
| T |
3914 |
gggttaataggtctttaccccctgtaatgtaggacacttttggttttgccccctgtaaaaaatttttttttgattcggtccttgtaaaaaaattttgttt |
4013 |
T |
 |
| Q |
222 |
tagaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
4014 |
tggaaaacccccc-tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgattacgtggcgcgctgactgtat |
4105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0725; HSP #2
Raw Score: 57; E-Value: 9e-24
Query Start/End: Original strand, 123 - 314
Target Start/End: Complemental strand, 5015 - 4823
Alignment:
| Q |
123 |
gggttaataggtctttaccccc--tgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnnttt-attcggtccttgtnnnnnnnttttgt |
219 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||||||||||||||||| ||| ||||||||||||| |||||| |
|
|
| T |
5015 |
gggttaataagtctttaccccccctgtaatataggtcacttttggttttgccccctgtaaattttttttttttgattcggtccttgtaaaatttttttgt |
4916 |
T |
 |
| Q |
220 |
tttagaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||| ||||| |||| ||||||||||||||||||||||||||||||||| | ||||||||||||| | ||||||||||| |||||||||| |
|
|
| T |
4915 |
tttggaaaacccacc-tagatcagctgactgtgcatttttgctgatgtggcatgctccgtcacctttttcag-tgacgtggcgcgctgactgtat |
4823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 75; Significance: 2e-34; HSPs: 152)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 121 - 314
Target Start/End: Complemental strand, 54567802 - 54567611
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnntttattcggtccttgtnnnnnnnttttgtt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | ||||||||||||| ||||||| |
|
|
| T |
54567802 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctataaaaaaaaaatttggattcggtccttgtaaaatttttttgtt |
54567703 |
T |
 |
| Q |
221 |
ttagaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|| ||||| |||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
54567702 |
ttggaaaaccccc--tagaccagctgactgtgcatttttgctgatgtggcatgctgtgtcaccttttttggatgacgtggcgcgctgactgtat |
54567611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 122 - 314
Target Start/End: Complemental strand, 29185039 - 29184847
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnntt-tattcggtccttgtnnnnnnnttttgtt |
220 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||||||||||||||||||||| ||||| || ||||| ||||||| ||||||| |
|
|
| T |
29185039 |
tgggttaataggcctttactccctgtaatataggtcacttttggttttgcctcctgtaaaaaaaaaaatttggattcgatccttgtaaaatttttttgtt |
29184940 |
T |
 |
| Q |
221 |
ttagaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||||||| |||||||||| |
|
|
| T |
29184939 |
ttggaaaa-cccccctagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttcggatgaagtggcgcgctgactgtat |
29184847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 38344325 - 38344247
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
38344325 |
tagaccagctgactgtgcatttttgctgatgtgacatgctgcgtcacctttttcggatgacgtggcgcgctgactgtat |
38344247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 123 - 314
Target Start/End: Complemental strand, 18142254 - 18142063
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnntt-tattcggtccttgtnnnnnnnttttgttt |
221 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||| ||||||||| |||||||| |
|
|
| T |
18142254 |
gggttaataggcctttaccccctgtaatataggtcacttttggttttgccccctgtaaaaaaaaaaaattggattaggtccttgtaaattttttttgttt |
18142155 |
T |
 |
| Q |
222 |
tagaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
| ||||| |||||||||||| ||||||||||||||||||||||||| | |||||||| |||| ||||||||||||| ||||| |||| |
|
|
| T |
18142154 |
tggaaaa-cccccctagaccagctgattgtgcatttttgctgatgtggcatgctacgtcacctctttcggatgacgtggcgcgctgaccgtat |
18142063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 123 - 314
Target Start/End: Original strand, 18140940 - 18141129
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnntttattcggtccttgtnnnnnnnttttgtttt |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||| |||||| | ||||||||||||| ||||||||| |
|
|
| T |
18140940 |
gggttaataggcctttaccccctgtaatataggtcacttttggttttgctccctgtaaaaaaaaaat-tgaattcggtccttgtaaaatttttttgtttt |
18141038 |
T |
 |
| Q |
223 |
agaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| ||| ||||| |||| ||||||||||| | |||||||||| |
|
|
| T |
18141039 |
ggaaaacccccc-tagaccagctgactgtgcatttttgctgatgtggcatgctgcatcaccctttttggatgacgtggcacgctgactgtat |
18141129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 243 - 314
Target Start/End: Complemental strand, 38243641 - 38243570
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
38243641 |
gctgactgtgcatttttgcttatgtggcatgatgcgtcacctttttctgatgacctggcgcgctgactgtat |
38243570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 31173530 - 31173452
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| |||||||||||||| ||||||||||||| ||||| |||| |
|
|
| T |
31173530 |
tagaccagctgactgtgcatttttgcagatgtggcatgctgcgtcaccttttttggatgacgtggcgcgctgaccgtat |
31173452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 46610008 - 46610064
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
46610008 |
tgggttaataggtctttaccccctgtaatatagggcacttttggttttgccccctgt |
46610064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 111 - 178
Target Start/End: Original strand, 10615263 - 10615330
Alignment:
| Q |
111 |
taataattgtttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||| ||| ||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
10615263 |
taattatttttttggttaataggtctttaccccctgtaatatagggcacttttggttttgccccctgt |
10615330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 37977563 - 37977508
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37977563 |
gggttaataggtctttaccccctgtaatataggacacttttggttttgccccctgt |
37977508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 4217789 - 4217867
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| |||||||| ||||| ||||||||||| | |||||||||| |
|
|
| T |
4217789 |
tagaccagctaactgtgcatttttgctgatgtggcatgctgcgtcactttttttggatgacgtggcacgctgactgtat |
4217867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 43112139 - 43112217
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||| ||| ||||||||||| |||||||||||| |||||||||| |
|
|
| T |
43112139 |
tagaccagctgattgtacatttttgctgatgtggcatgctgcatcacctttttcggatgacgtggcgtgctgactgtat |
43112217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 48044387 - 48044461
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |||| |||| ||||| |
|
|
| T |
48044387 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcaccttttttggattacgtagcgcgctgattgtat |
48044461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 240 - 300
Target Start/End: Complemental strand, 51545147 - 51545087
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtgg |
300 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
51545147 |
ccagctgactatgcattttcgctgatgtggcatgttgcgttacctttttctgatgacgtgg |
51545087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 239 - 314
Target Start/End: Complemental strand, 43112980 - 43112905
Alignment:
| Q |
239 |
accagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||| |||||||||||||| | ||||||||||| |||||||||| |
|
|
| T |
43112980 |
accagctgactatgcatttttgttgatgtggcatgctgcgtcaccttttttggttgacgtggcgcgctgactgtat |
43112905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 46597565 - 46597510
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
46597565 |
gggttaataggtctttaccccctgtaatatagggcacttttggttttgcctcctgt |
46597510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 243 - 314
Target Start/End: Original strand, 48076442 - 48076513
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||| ||||| |||||| ||||||| ||||||||| |
|
|
| T |
48076442 |
gctgactgtgcatttttgctgatgtggcatgatgcgtcacatttttttgatgatgtggcgcgttgactgtat |
48076513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 50 - 116
Target Start/End: Complemental strand, 20916465 - 20916399
Alignment:
| Q |
50 |
gagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctattaactaataa |
116 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||| ||| || ||||||| |
|
|
| T |
20916465 |
gagcgacctcattcgcttgcctcctattgaactcaacataagagttctgaaaactactatctaataa |
20916399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 50 - 116
Target Start/End: Complemental strand, 20925427 - 20925361
Alignment:
| Q |
50 |
gagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctattaactaataa |
116 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||| ||| || ||||||| |
|
|
| T |
20925427 |
gagcgacctcattcgcttgcctcctattgaactcaacataagagttctgaaaactactatctaataa |
20925361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 242 - 312
Target Start/End: Complemental strand, 25309102 - 25309032
Alignment:
| Q |
242 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgt |
312 |
Q |
| |
|
|||||||| ||||||||||||||||||||| | || |||||||||||||||||| ||||||| |||||||| |
|
|
| T |
25309102 |
agctgactatgcatttttgctgatgtggcacgctgagtcacctttttctgatgatgtggcgcgctgactgt |
25309032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 29183844 - 29183922
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||| || ||||||| |||| | |||| ||||||||||||| |||||||||| |
|
|
| T |
29183844 |
tagaccagctgactgtgcatttttgctgatatgacatgttgtgtcagcctttttggatgacgtggcgcgctgactgtat |
29183922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 54566623 - 54566701
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||| ||| |||||||||||| |||||||||| || ||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
54566623 |
tagaccagctaactatgcatttttgctaatgtggcatgatgtgtcaccttttttggatgacgtggcgcgctgactgtat |
54566701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 241 - 314
Target Start/End: Original strand, 11359574 - 11359647
Alignment:
| Q |
241 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | || |||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
11359574 |
cagctgactgtgcattttcgctgatgtggcacgctgagtcaccgttttctgatgacgtggcacgctgactgtat |
11359647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 125 - 178
Target Start/End: Original strand, 48044276 - 48044329
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
48044276 |
gttaataggtctttaccccctgtgatatagggcacttttggttttgccccctgt |
48044329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 10616831 - 10616775
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
10616831 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
10616775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 15086222 - 15086278
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
15086222 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
15086278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 9 - 112
Target Start/End: Original strand, 1017640 - 1017743
Alignment:
| Q |
9 |
atggggactatgattagatagggttgtctaaactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctatta |
108 |
Q |
| |
|
|||||| ||| |||||||||||| ||||| | |||| | |||||| ||| ||| | |||||||| ||||||||||||||||||||||||||||||| | |
|
|
| T |
1017640 |
atgggggctaggattagatagggctgtctgagctaactcgtgagctaccctatttgcttgcctccggttgaactcaacatgagagttctgaaatctatca |
1017739 |
T |
 |
| Q |
109 |
acta |
112 |
Q |
| |
|
|||| |
|
|
| T |
1017740 |
acta |
1017743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 4218923 - 4218868
Alignment:
| Q |
124 |
ggttaataggtctttaccccctg-taatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4218923 |
ggttaataggcctttaccccctggtaatataggtcacttttggttttgccccctgt |
4218868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 7248865 - 7248920
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
7248865 |
gggttaataggcctttaccccctgtaatatagatcatttttggttttgccccctgt |
7248920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 243 - 314
Target Start/End: Original strand, 49263149 - 49263220
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||| ||||||||||||| || ||||||||||| ||||||| || ||| |||||||||| |
|
|
| T |
49263149 |
gctgactgtgcatttttcctgatgtggcatgctgtgtcacctttttatgatgacatgacgcgctgactgtat |
49263220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 240 - 314
Target Start/End: Complemental strand, 2305445 - 2305371
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||| |||||| ||||| | || |||||| |||| |||||||||||||| |||||||||| |
|
|
| T |
2305445 |
ccagctgactgtgcattttcgctgatttggcacgctgagtcaccattttttgatgacgtggcgcgctgactgtat |
2305371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 117 - 178
Target Start/End: Original strand, 14824744 - 14824806
Alignment:
| Q |
117 |
ttgtttgggttaataggtctttac-cccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
14824744 |
ttgtttgggttaatagtgctttacgcccctgtaatataggtcacttttgattttgccccctgt |
14824806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 34061462 - 34061536
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| |||| |||| |||||||||||| |||||||||| |
|
|
| T |
34061462 |
ccagctgactgtgcatttttgctgatgtggcatgctgcatcacaattttatgatgacgtggcatgctgactgtat |
34061536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 47115622 - 47115573
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
47115622 |
tttgggttaataggtctttaccccctgtaatataggtcattttcggtttt |
47115573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 122 - 174
Target Start/End: Original strand, 12210027 - 12210079
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12210027 |
tgggttaatagacttttaccccctgtaatataggtcacttttggttttgcccc |
12210079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 114 - 170
Target Start/End: Original strand, 31172290 - 31172346
Alignment:
| Q |
114 |
taattgtttgggttaataggtctttaccccctgtaatataggtcacttttggttttg |
170 |
Q |
| |
|
||||| |||||||||||||| ||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
31172290 |
taattttttgggttaataggcctttaccacctgtaatataggtcatttttggttttg |
31172346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 11359457 - 11359508
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
11359457 |
gggttaataggcctttaccccctgcaatataggtcacttttggttttccccc |
11359508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 11360408 - 11360349
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||| |||||||||| || |||||||||||||||||||||| |||||||| |
|
|
| T |
11360408 |
tttgggttaataggcctttacccccctgcaatataggtcacttttggttttcccccctgt |
11360349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 240 - 314
Target Start/End: Complemental strand, 24910874 - 24910799
Alignment:
| Q |
240 |
ccagctgactgtgcattttt-gctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||| |||||| ||||||| |||||||| |||||| |||||||||| || |||| ||||| |
|
|
| T |
24910874 |
ccagctgactgtgcattttttgctgatttggcatgctgcgtcacttttttcggatgacgtggtgcgctgattgtat |
24910799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 125 - 172
Target Start/End: Complemental strand, 24910986 - 24910939
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggttttgcc |
172 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24910986 |
gttaatagatctttaccccctgtaatatagatcacttttggttttgcc |
24910939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 121 - 172
Target Start/End: Original strand, 29183730 - 29183781
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggttttgcc |
172 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||||||||| ||||||| |
|
|
| T |
29183730 |
ttgggttaataggtctttatcccctataatataggtcacttttgattttgcc |
29183781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 31835898 - 31835843
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||| ||||||||||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
31835898 |
gggttaatatgtctttaccccctgtaatatatgacacttttgattttgccccctgt |
31835843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 45291420 - 45291471
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||| | | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45291420 |
gggttaatatgcccttaccccctgtaatataggtcacttttggttttgcccc |
45291471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 4217673 - 4217731
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||| ||||||| |||||||| |||| |
|
|
| T |
4217673 |
tttggattaataggcctttaccccctgtaatataggtaacttttgattttgccctctgt |
4217731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 51 - 101
Target Start/End: Complemental strand, 8705767 - 8705717
Alignment:
| Q |
51 |
agcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaa |
101 |
Q |
| |
|
|||||||||||| | |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8705767 |
agcgacctcattagcttgcctcctattgaactcgacatgagagttctgaaa |
8705717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 51 - 101
Target Start/End: Complemental strand, 9057654 - 9057604
Alignment:
| Q |
51 |
agcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaa |
101 |
Q |
| |
|
|||||||||||| | |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9057654 |
agcgacctcattagcttgcctcctattgaactcgacatgagagttctgaaa |
9057604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 240 - 314
Target Start/End: Complemental strand, 11360288 - 11360214
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||| |||||||||| |||||||||||| | || |||| | ||||||||||||||||| | |||||||||| |
|
|
| T |
11360288 |
ccagctgaatgtgcattttcgctgatgtggcacgctgagtcaacgttttctgatgacgtggcacgctgactgtat |
11360214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 123 - 173
Target Start/End: Original strand, 12066229 - 12066279
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccc |
173 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
12066229 |
gggttaatagttttttaccccctgtaatataggtcacttttgattttgccc |
12066279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 126 - 176
Target Start/End: Complemental strand, 31173638 - 31173589
Alignment:
| Q |
126 |
ttaataggtctttaccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
31173638 |
ttaataggtctttacccc-tgtaatatagatcacttttggttttgccccct |
31173589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 41749383 - 41749441
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||| |||| ||||||| |
|
|
| T |
41749383 |
tttgggttaataggcctttaccccttgtaatataggtcacttttgattttctcccctgt |
41749441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 51460820 - 51460774
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
51460820 |
gggttaataggtctttaccccctgtaatataggtcattttttgtttt |
51460774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 21 - 106
Target Start/End: Original strand, 10346509 - 10346594
Alignment:
| Q |
21 |
attagatagggttgtctaaactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctat |
106 |
Q |
| |
|
|||| ||||||||| || | |||| | |||||||||| ||||| ||||||||| |||||||| ||||| |||||||||||||||| |
|
|
| T |
10346509 |
attatatagggttgcctgagctaactcgtgagcgaccctattcgcttgcctcctgttgaactctacatgcgagttctgaaatctat |
10346594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 41 - 106
Target Start/End: Complemental strand, 27265863 - 27265798
Alignment:
| Q |
41 |
ctaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctat |
106 |
Q |
| |
|
|||||| ||||||||||||||| ||||| ||| |||| ||||||||||||||||| ||||| |||| |
|
|
| T |
27265863 |
ctaattcgtgagcgacctcattagtttgtctcttattaaactcaacatgagagttttgaaacctat |
27265798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 41 - 106
Target Start/End: Complemental strand, 37796670 - 37796605
Alignment:
| Q |
41 |
ctaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctat |
106 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||| ||||| ||||||| ||| ||||| |||| |
|
|
| T |
37796670 |
ctaatttgtgagcgacctcattagcttgcctcctattaaactcgacatgagtgttttgaaaactat |
37796605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 241 - 314
Target Start/End: Complemental strand, 46207905 - 46207832
Alignment:
| Q |
241 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||| ||| |||||||| | || ||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
46207905 |
cagctgactgtgcattttcgctaatgtggcacgctgattcaccattttctgatgacgtggcgcgttgactgtat |
46207832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 121 - 158
Target Start/End: Complemental strand, 49880796 - 49880759
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49880796 |
ttgggttaataggtctttaccccctgtaatataggtca |
49880759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 22256202 - 22256258
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||| ||||||||||| |||||||||| | |||||||||||||||||||||| |
|
|
| T |
22256202 |
gggttaataagtctttacccccctgtaatatatgacacttttggttttgccccctgt |
22256258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 24729688 - 24729632
Alignment:
| Q |
123 |
gggttaataggtctttac-cccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||| |||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
24729688 |
gggttaataggcctttactcccctgtaatataggttacttttggttttgcctcctgt |
24729632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 28206982 - 28207038
Alignment:
| Q |
123 |
gggttaataggtctttaccc-cctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
28206982 |
gggttaatagggctttaccctcctgtaatatagggcacttttggttttcccccctgt |
28207038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 49 - 101
Target Start/End: Complemental strand, 36684962 - 36684910
Alignment:
| Q |
49 |
tgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaa |
101 |
Q |
| |
|
||||||||| |||| | |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
36684962 |
tgagcgaccccattagcttgcctcctattgaactcgacatgagagttctgaaa |
36684910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 175
Target Start/End: Original strand, 38343184 - 38343236
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccc |
175 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| |||||||||| |||||||||| |
|
|
| T |
38343184 |
gggttaataggcctttacctcctgtaatatatgtcacttttgattttgccccc |
38343236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 38843607 - 38843551
Alignment:
| Q |
123 |
gggttaataggtctttaccccct-gtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||| ||||||||||||||| | |||||||||| |||||||||||||||||||||| |
|
|
| T |
38843607 |
gggttgataggtctttacccctttgtaatataggacacttttggttttgccccctgt |
38843551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 51252342 - 51252286
Alignment:
| Q |
123 |
gggttaataggtcttta-ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| || ||||||| |||||||| |
|
|
| T |
51252342 |
gggttaataggtctttatccccctgtaatataggtcatttctggttttcccccctgt |
51252286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 2305560 - 2305509
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||| | |||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
2305560 |
gggttaataagcctttaccccctgcaatataggtcacttttggttttccccc |
2305509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 6510215 - 6510250
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6510215 |
gggttaataggtctttaccccctgtaatataggtca |
6510250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 7118084 - 7118143
Alignment:
| Q |
120 |
tttgggttaataggtctttac-cccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| || |||||| |||||||| |
|
|
| T |
7118084 |
tttgggttaataggtctttacacccctgtaatataggtcatttccggttttcccccctgt |
7118143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 8355627 - 8355572
Alignment:
| Q |
120 |
tttgggttaataggtctttac-cccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| || ||||||| |||| |
|
|
| T |
8355627 |
tttgggttaataggtctttacccccctgtaatataggtcatttctggttttccccc |
8355572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 14826132 - 14826077
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| ||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14826132 |
gggttaatagtgttttaccccctgtaatatttgtcacttttggttttgccccctgt |
14826077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 22257393 - 22257338
Alignment:
| Q |
120 |
tttgggttaataggtctttac-cccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||| ||||||| |||||||||| |
|
|
| T |
22257393 |
tttgggttaataggtctttacccccctgtattatagggcactttttgttttgcccc |
22257338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 24909380 - 24909435
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| | ||||||||||||| ||||| |
|
|
| T |
24909380 |
gggttaataggcatttaccccctgtaatataggtaaattttggttttgcctcctgt |
24909435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 25110118 - 25110063
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| ||| |||||| | |||||| |
|
|
| T |
25110118 |
gggttaataggtctttacaccctgtaatataggtcattttcggttttcctccctgt |
25110063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 27521521 - 27521576
Alignment:
| Q |
124 |
ggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| | |||||||||| |||||||| |
|
|
| T |
27521521 |
ggttaataggtctttacccccgtgtaatataggttatttttggttttcccccctgt |
27521576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 135 - 178
Target Start/End: Complemental strand, 34062383 - 34062340
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34062383 |
ctttatcccctgtaatataggtcacttttggtttttccccctgt |
34062340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 43112026 - 43112081
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| ||||||| ||||||||||| |||||||||||||| |||||||| |
|
|
| T |
43112026 |
gggttaataggcctttacctcctgtaatataaatcacttttggttttaccccctgt |
43112081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 48044672 - 48044593
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctga-tgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||| |||| | ||| ||||||| | || |||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
48044672 |
tagaccagctgactgtgccttttcgttgaatgtggcacgctgagtcaccgttttctgatgacgtggcgcgttgactgtat |
48044593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 49873006 - 49872971
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
49873006 |
gggttaataggtctttaccccctgtaatataggtca |
49872971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 54566512 - 54566566
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
54566512 |
gggttaatagacctttacccc-tgtaatataggtcacttttggttttgtcccctgt |
54566566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 136 - 178
Target Start/End: Complemental strand, 12072908 - 12072866
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
12072908 |
tttaccccccgtaatataggtcacttttggttttgcccgctgt |
12072866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 19756859 - 19756917
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| | ||||||||||| |||||||||||| |||||||||| |||||||| |
|
|
| T |
19756859 |
tttgggttaatggtgctttaccccctataatataggtcatttttggttttcccccctgt |
19756917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 27760289 - 27760335
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| || ||||||| |
|
|
| T |
27760289 |
gggttaataagtctttaccccctgtaatataggtcatttctggtttt |
27760335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 29313789 - 29313843
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||| |||||| ||||||| |
|
|
| T |
29313789 |
ggttaataggtctttacctcctgtaatataggtcattttcggttttctcccctgt |
29313843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 236 - 286
Target Start/End: Complemental strand, 34062280 - 34062230
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcaccttt |
286 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| | |||| ||||||||| |
|
|
| T |
34062280 |
tagacctgctgactgtgcatttttgctgatgtggtaagttgtgtcaccttt |
34062230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 49263029 - 49263075
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||||||||| |||| |
|
|
| T |
49263029 |
gggttaataggtctttaccccctataatatagatcacttttgatttt |
49263075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 158
Target Start/End: Original strand, 22949248 - 22949281
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
22949248 |
gttaataggtctttaccccctgtaatataggtca |
22949281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 38344445 - 38344383
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatata----ggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
38344445 |
tttgggttaataggcatttaccccctgtaatatatataggtcacttttgattttgccccctgt |
38344383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 41 - 106
Target Start/End: Complemental strand, 38998972 - 38998907
Alignment:
| Q |
41 |
ctaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctat |
106 |
Q |
| |
|
|||||| |||||||||| |||| | |||||||||||| ||||| ||||||||||| ||||| |||| |
|
|
| T |
38998972 |
ctaattcgtgagcgaccccattagcttgcctcctattaaactcgacatgagagttttgaaaactat |
38998907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 130 - 167
Target Start/End: Complemental strand, 43113087 - 43113050
Alignment:
| Q |
130 |
taggtctttaccccctgtaatataggtcacttttggtt |
167 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
43113087 |
taggcctttaccccctgtaatataggtcacttttggtt |
43113050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 178
Target Start/End: Complemental strand, 45334080 - 45334027
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||| |||||||||| ||| |||| |
|
|
| T |
45334080 |
gttaatggttctttaccccctgtaatataggtcatttttggtttttccctctgt |
45334027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 126 - 158
Target Start/End: Complemental strand, 8827479 - 8827447
Alignment:
| Q |
126 |
ttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
8827479 |
ttaataggtctttaccccctgtaatataggtca |
8827447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 236 - 268
Target Start/End: Original strand, 38343296 - 38343328
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtg |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38343296 |
tagaccagctgactgtgcatttttgctgatgtg |
38343328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 244 - 288
Target Start/End: Original strand, 45291539 - 45291583
Alignment:
| Q |
244 |
ctgactgtgcatttttgctgatgtggcatgttgcgtcaccttttt |
288 |
Q |
| |
|
||||||||||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
45291539 |
ctgactgtgcattttcgctaatgtgacatgttgcgtcaccttttt |
45291583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 243 - 291
Target Start/End: Original strand, 49523548 - 49523596
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctg |
291 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
49523548 |
gctgactgtgaatttttgctgatgatgcatgttgtgtcacctttttctg |
49523596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 101
Target Start/End: Complemental strand, 51976817 - 51976765
Alignment:
| Q |
49 |
tgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaa |
101 |
Q |
| |
|
||||||||| |||| | |||||||||||||||||| |||||||||||||||| |
|
|
| T |
51976817 |
tgagcgaccccattggcttgcctcctattgaactcggcatgagagttctgaaa |
51976765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 3548416 - 3548361
Alignment:
| Q |
120 |
tttgggttaataggtctttacccc-ctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||| | ||| |||||| |||| |
|
|
| T |
3548416 |
tttgggttaataggtctttacccctctgtaatataggttattttcggttttccccc |
3548361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 260 - 303
Target Start/End: Original strand, 12210148 - 12210191
Alignment:
| Q |
260 |
gctgatgtggcatgttgcgtcacctttttctgatgacgtggcgc |
303 |
Q |
| |
|
|||||||||||||| ||||||||||||||| ||||| ||||||| |
|
|
| T |
12210148 |
gctgatgtggcatgctgcgtcacctttttcggatgatgtggcgc |
12210191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 14241214 - 14241249
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| |
|
|
| T |
14241214 |
gggtttataggtctttaccccctgtaatataggtca |
14241249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 15093771 - 15093716
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||| ||||||| ||||||||||||| |
|
|
| T |
15093771 |
gggttaatagaactttaccccctataatatagggtacttttgattttgccccctgt |
15093716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 178
Target Start/End: Original strand, 17261037 - 17261080
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| || ||||| |
|
|
| T |
17261037 |
ctttaccccctgtaatataggtcatttttggttttccctcctgt |
17261080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 154
Target Start/End: Complemental strand, 20957226 - 20957195
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatatag |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
20957226 |
gggttaataggtctttaccccctgtaatatag |
20957195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 236 - 271
Target Start/End: Original strand, 24909493 - 24909528
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggca |
271 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||| |
|
|
| T |
24909493 |
tagaccagctgactatgcatttttgctgatgtggca |
24909528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 77 - 112
Target Start/End: Original strand, 26730953 - 26730988
Alignment:
| Q |
77 |
tgaactcaacatgagagttctgaaatctattaacta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
26730953 |
tgaactcaacatgagagttctgaaatctatcaacta |
26730988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 27497799 - 27497834
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27497799 |
gggttaataggtctttaccccctgtaatataagtca |
27497834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 30271834 - 30271779
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||| |||| ||||| ||||||| |
|
|
| T |
30271834 |
gggttaataggtctttacctcctgtaatatatgtcattttttgttttcacccctgt |
30271779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 30586459 - 30586400
Alignment:
| Q |
120 |
tttgggttaataggtctttac-cccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| |||| ||||||||||||| || ||||||| ||||||| |
|
|
| T |
30586459 |
tttgggttaataggtctttaccccccagtaatataggtcatttctggttttcacccctgt |
30586400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 178
Target Start/End: Complemental strand, 35434117 - 35434074
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| || ||||| |
|
|
| T |
35434117 |
ctttaccccctgtaatataggtcatttttggttttccctcctgt |
35434074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 174
Target Start/End: Complemental strand, 39846625 - 39846586
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
39846625 |
ctttaccccctgtaatataggtcatttttggtttttcccc |
39846586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 40462800 - 40462745
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||| |||| ||||| || ||||| |
|
|
| T |
40462800 |
gggttaataggtctttaccccatataatataggtcattttttgtttttcctcctgt |
40462745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 170
Target Start/End: Original strand, 46596095 - 46596142
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttg |
170 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
46596095 |
gggttaatagagctttaccccctgtaatatagggtacttttggttttg |
46596142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 49265348 - 49265297
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||| ||||| | |||||||||||||||||||||||||| |||| |
|
|
| T |
49265348 |
gggttaataggcatttactctctgtaatataggtcacttttggttttccccc |
49265297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 51252049 - 51252104
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| | || ||||||| ||| |||| |
|
|
| T |
51252049 |
gggttaataggtctttactccctgtaatataggttatttctggttttcccctctgt |
51252104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 53806853 - 53806818
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
53806853 |
gggttaataggtctttaccccttgtaatataggtca |
53806818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 178
Target Start/End: Complemental strand, 54012633 - 54012590
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| | |||||| |
|
|
| T |
54012633 |
ctttaccccctgtaatataggtcatttttggttttcctccctgt |
54012590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 135 - 169
Target Start/End: Complemental strand, 1351512 - 1351478
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
1351512 |
ctttaccccctgtaatataggtcatttttggtttt |
1351478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 136 - 170
Target Start/End: Complemental strand, 3190670 - 3190636
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttttg |
170 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
3190670 |
tttaccccctgtaatataggccacttttggttttg |
3190636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 136 - 170
Target Start/End: Complemental strand, 3207595 - 3207561
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttttg |
170 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
3207595 |
tttaccccctgtaatataggccacttttggttttg |
3207561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 3841181 - 3841227
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||| | |||||||| |||||||||||||||| |||||||||| |
|
|
| T |
3841181 |
gggttaatggttctttaccacctgtaatataggtcatttttggtttt |
3841227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 135 - 169
Target Start/End: Original strand, 11761094 - 11761128
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
11761094 |
ctttaccccctgtaatataggtcatttttggtttt |
11761128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 120 - 158
Target Start/End: Complemental strand, 14248874 - 14248836
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
14248874 |
tttgggttaataggtctttaccccccgtaaaataggtca |
14248836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 140 - 174
Target Start/End: Complemental strand, 19111297 - 19111263
Alignment:
| Q |
140 |
ccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| |
|
|
| T |
19111297 |
ccccctgtaatataggtcacttttggttttacccc |
19111263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 19624067 - 19624021
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||| ||| |||||| |
|
|
| T |
19624067 |
gggttaataggtctttatcctctgtaatataggtcattttcggtttt |
19624021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 121 - 174
Target Start/End: Original strand, 20956941 - 20956995
Alignment:
| Q |
121 |
ttgggttaataggtctttac-cccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |||| ||||| |||| |||| |
|
|
| T |
20956941 |
ttgggttaataggtctttacacccctgtaatatatgtcatttttgattttccccc |
20956995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 23539262 - 23539319
Alignment:
| Q |
123 |
gggttaataggtctttacccc--ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| ||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
23539262 |
gggttaataggcctttaccccccctgtaatatacaccacttttggttttgccccctgt |
23539319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 122 - 163
Target Start/End: Original strand, 27432681 - 27432723
Alignment:
| Q |
122 |
tgggttaataggtcttta-ccccctgtaatataggtcactttt |
163 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
27432681 |
tgggttaataggtctttacccccctgtaatataggtcattttt |
27432723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 113 - 174
Target Start/End: Complemental strand, 28208212 - 28208150
Alignment:
| Q |
113 |
ataattgtttgggttaataggtctttaccccc-tgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||| || |||||||||| |||||||||| ||||||||||| ||||||||||||| |||| |
|
|
| T |
28208212 |
ataatttttagggttaatagagctttacccccctgtaatatagggcacttttggttttccccc |
28208150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 30271544 - 30271590
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||| |||| ||||| |
|
|
| T |
30271544 |
gggttaatagttctttaccctctgtaatataggtcatttttagtttt |
30271590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 128 - 169
Target Start/End: Original strand, 40462525 - 40462567
Alignment:
| Q |
128 |
aataggtctttaccccct-gtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
40462525 |
aataggtctttacccccttgtaatataggtcacttctggtttt |
40462567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 135 - 169
Target Start/End: Original strand, 45151637 - 45151671
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
45151637 |
ctttaccccctgtaatataggtcatttttggtttt |
45151671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 67 - 101
Target Start/End: Complemental strand, 45736505 - 45736471
Alignment:
| Q |
67 |
tgcctcctattgaactcaacatgagagttctgaaa |
101 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
45736505 |
tgcctcctattgaactcgacatgagagttctgaaa |
45736471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 49872713 - 49872770
Alignment:
| Q |
123 |
gggttaataggtctttacccc--ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| || ||||||| ||||||| |
|
|
| T |
49872713 |
gggttaataggtctttaccccccctgtaatataggtcatttctggttttcacccctgt |
49872770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 51544273 - 51544351
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||| |||| |||||||||||| | ||| |||||||| || ||||| |||||||||||| ||||| | ||||||||| |
|
|
| T |
51544273 |
tagactagctaactgtgcattttcgttgacgtggcatgatgtgtcacatttttctgatgatgtggcacgttgactgtat |
51544351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 54087519 - 54087577
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| | ||||||||||| |||||||||||| |||| ||||| |||||||| |
|
|
| T |
54087519 |
tttgggttaatggtgctttaccccctctaatataggtcattttttgttttcccccctgt |
54087577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 136 - 173
Target Start/End: Original strand, 12071527 - 12071564
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttttgccc |
173 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
12071527 |
tttaccccccgtaatataggtcacttttgattttgccc |
12071564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 120 - 169
Target Start/End: Original strand, 25109830 - 25109879
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||| | ||||||||||||||| || ||||||| |
|
|
| T |
25109830 |
tttgggttaataggtctttatcttctgtaatataggtcatttatggtttt |
25109879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 123 - 163
Target Start/End: Complemental strand, 27432879 - 27432838
Alignment:
| Q |
123 |
gggttaataggtctttacc-ccctgtaatataggtcactttt |
163 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
27432879 |
gggttaataggtctttacctccctgtaatataggtcattttt |
27432838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 249 - 314
Target Start/End: Original strand, 41749511 - 41749576
Alignment:
| Q |
249 |
tgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||| |||||||| |||||||||||| |||||| | ||||| |||| | |||||||||| |
|
|
| T |
41749511 |
tgtgcattttcgctgatgtaacatgttgcgtcatctttttttaatgacatggcacgctgactgtat |
41749576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 42349069 - 42349012
Alignment:
| Q |
122 |
tgggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||||||| || |||||| |||||||| |
|
|
| T |
42349069 |
tgggttaataggtctttagccccatgtaatataggtcatttccggttttcccccctgt |
42349012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 158
Target Start/End: Complemental strand, 47117609 - 47117576
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
47117609 |
gttaataggtctttaccccttgtaatataggtca |
47117576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 79 - 112
Target Start/End: Original strand, 47703819 - 47703852
Alignment:
| Q |
79 |
aactcaacatgagagttctgaaatctattaacta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| |
|
|
| T |
47703819 |
aactcaacatgagagttctgaaatctatcaacta |
47703852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 124 - 169
Target Start/End: Complemental strand, 52396499 - 52396454
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||| ||||||| |
|
|
| T |
52396499 |
ggttaatagggctttaccccctgtaatatagagcacttctggtttt |
52396454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 55 - 95
Target Start/End: Original strand, 2651825 - 2651865
Alignment:
| Q |
55 |
acctcattcgtttgcctcctattgaactcaacatgagagtt |
95 |
Q |
| |
|
||||||||||||||||||||| | ||||| ||||||||||| |
|
|
| T |
2651825 |
acctcattcgtttgcctcctaataaactcgacatgagagtt |
2651865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 4699975 - 4700011
Alignment:
| Q |
123 |
gggttaataggtctttacc-ccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4699975 |
gggttaataggtctttacctccctgtaatataggtca |
4700011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 5205116 - 5205172
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||| || |||||| |||||||| |
|
|
| T |
5205116 |
gggttaataggtttttacccccctgtaatataggtcatttccggttttcccccctgt |
5205172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 5205412 - 5205356
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||| || |||||| |||||||| |
|
|
| T |
5205412 |
gggttaataggtttttacccccctgtaatataggtcatttccggttttcccccctgt |
5205356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 125 - 169
Target Start/End: Original strand, 12766941 - 12766985
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||| ||| |||||| |
|
|
| T |
12766941 |
gttaataggtctttaccccttgtaatatagatcattttcggtttt |
12766985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 125 - 169
Target Start/End: Complemental strand, 18028060 - 18028016
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||| |||||||||||| |||| ||||||||||||||||| |
|
|
| T |
18028060 |
gttaatagacctttaccccctgcaatacaggtcacttttggtttt |
18028016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 18704953 - 18705009
Alignment:
| Q |
123 |
gggttaataggtctttaccccct-gtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| |||||||||| |||||||||| ||||||||||||| |||||||| |
|
|
| T |
18704953 |
gggttaatagagctttaccccccagtaatatagggcacttttggttttcccccctgt |
18705009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 135 - 178
Target Start/End: Original strand, 18945811 - 18945855
Alignment:
| Q |
135 |
ctttaccc-cctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||| |||||||| |
|
|
| T |
18945811 |
ctttacccacctgtaatataggtcatttttggttttaccccctgt |
18945855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 30586162 - 30586198
Alignment:
| Q |
123 |
gggttaataggtcttta-ccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30586162 |
gggttaataggtctttacccccctgtaatataggtca |
30586198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 120 - 168
Target Start/End: Original strand, 33898070 - 33898118
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttt |
168 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||| |||| |||| |
|
|
| T |
33898070 |
tttgggttaatggtgctttaccccctgtaatataggtcattttttgttt |
33898118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 140 - 176
Target Start/End: Original strand, 37975987 - 37976023
Alignment:
| Q |
140 |
ccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37975987 |
ccccctgtaatatagggtacttttggttttgccccct |
37976023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 135 - 175
Target Start/End: Original strand, 41301056 - 41301096
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccc |
175 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||| ||||| |
|
|
| T |
41301056 |
ctttaccccctgcaatataggtcatttttggttttcccccc |
41301096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 243 - 271
Target Start/End: Complemental strand, 49265229 - 49265201
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggca |
271 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
49265229 |
gctgactgtgcatttttgctgatgtggca |
49265201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 74; Significance: 7e-34; HSPs: 106)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 123 - 314
Target Start/End: Complemental strand, 3063540 - 3063350
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnnttt-attcggtccttgtnnnnnnnttttgttt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| || || ||||||||||||| |||||||| |
|
|
| T |
3063540 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccttgaaaaaaaaaaaaattggattcggtccttgtaaaatttttttgttt |
3063441 |
T |
 |
| Q |
222 |
tagaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
| ||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
3063440 |
tggaaaaccccc--tagaccagctgactgtgcatttttgctgatgtggcatgctgcgtcacctttttcggatgacgtggcgcgctgactgtat |
3063350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 121 - 314
Target Start/End: Complemental strand, 14328705 - 14328513
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnntt-tattcggtccttgtnnnnnnnttttgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||| |||||| |
|
|
| T |
14328705 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtaaaaaaaaaactttagattcgatccttgtaaaatttttttgt |
14328606 |
T |
 |
| Q |
220 |
tttagaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||| ||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||| |||||||||||| |||||||||| |
|
|
| T |
14328605 |
tttggaaaa-cccccctagaccagctgactgtgcatttttgctgatgtggcatgttccgtca-cttttttggatgacgtggcgggctgactgtat |
14328513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 121 - 314
Target Start/End: Complemental strand, 14421715 - 14421523
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnntt-tattcggtccttgtnnnnnnnttttgt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| ||||||| |||||| |
|
|
| T |
14421715 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtaaaaaaaaaactttagattcgatccttgtaaaatttttttgt |
14421616 |
T |
 |
| Q |
220 |
tttagaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||| ||||| |||||||||||||||||||||||||||||||||||||||| ||||| |||||| |||||||||||| |||||||||| |
|
|
| T |
14421615 |
tttggaaaa-cccccctagaccagctgactgtgcatttttgctgatgtggcatgttccgtca-cttttttggatgacgtggcgggctgactgtat |
14421523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 26470200 - 26470122
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
26470200 |
tagaccagttgactgtgcatttttgctgatgtggcatgctgcgtcaccttttttggatgacgtggcgcgctgactgtat |
26470122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 3062302 - 3062380
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| ||| ||||||||||||| |||||||||| |
|
|
| T |
3062302 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgtgtcacccattttggatgacgtggcgcgctgactgtat |
3062380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 20754517 - 20754439
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||| ||||||||||||| || ||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
20754517 |
tagaccagctgactgtacatttttgctgatatgacatgttgcgtcaccttttttggatgacgtggcgcgctgactgtat |
20754439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 243 - 314
Target Start/End: Complemental strand, 26644629 - 26644558
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||| ||||||| |||| |||||||||||| |
|
|
| T |
26644629 |
gctgactgtgcatttttgctgatgtggattgttgggtcacctttttttgatgacatggcacactgactgtat |
26644558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 243 - 314
Target Start/End: Complemental strand, 26750595 - 26750524
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||||||||| ||||||| |||| |||||||||||| |
|
|
| T |
26750595 |
gctgactgtgcatttttgctgatgtggattgttgggtcacctttttttgatgacatggcacactgactgtat |
26750524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 3119437 - 3119511
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | || |||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
3119437 |
ccagctgactgtgcattttcgctgatgtggcacgctgagtcaccattttctgatgacgtggcgcgttgactgtat |
3119511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 14327370 - 14327424
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14327370 |
ggttaataggcctttaccccctgtaatatacgtcacttttggttttgccccctgt |
14327424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 14420380 - 14420434
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
14420380 |
ggttaataggcctttaccccctgtaatatacgtcacttttggttttgccccctgt |
14420434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 20753395 - 20753472
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| | |||| |||||||||||| |||||||||| |
|
|
| T |
20753395 |
tagaccagctgactgtgcatttttgctgatgtggcatgctgcgtcaacatttt-gaatgacgtggcgcgctgactgtat |
20753472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 22058337 - 22058280
Alignment:
| Q |
122 |
tgggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
22058337 |
tgggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
22058280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 245 - 302
Target Start/End: Complemental strand, 24387698 - 24387641
Alignment:
| Q |
245 |
tgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcg |
302 |
Q |
| |
|
||||||||||||||||||||||||| ||| || ||||||||||||||||||||||||| |
|
|
| T |
24387698 |
tgactgtgcatttttgctgatgtggtatgctgtgtcacctttttctgatgacgtggcg |
24387641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 249 - 302
Target Start/End: Original strand, 25385465 - 25385518
Alignment:
| Q |
249 |
tgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcg |
302 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25385465 |
tgtgcatttttgctgaggtggcatgttgcgtcacctttttcggatgacgtggcg |
25385518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 24234329 - 24234385
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
24234329 |
gggttaataggtctttacccccctgtaatataggacacttttggttttgccccctgt |
24234385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 24235688 - 24235632
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
24235688 |
gggttaataggtctttacccctctgtaatatagggcacttttggttttgccccctgt |
24235632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 56169 - 56114
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||| ||||| ||||||| |
|
|
| T |
56169 |
gggttaataggtctttaccccctgtaatatagggcacttttgattttgtcccctgt |
56114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 243 - 314
Target Start/End: Original strand, 26644206 - 26644277
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||| |||| |||||||||||| ||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
26644206 |
gctgactgtgccttttatatgatgtggcatgatgcgtcacctttttctgatgacgtgacgcgctgactgtat |
26644277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 243 - 314
Target Start/End: Original strand, 26750172 - 26750243
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||| |||| |||||||||||| ||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
26750172 |
gctgactgtgccttttatatgatgtggcatgatgcgtcacctttttctgatgacgtgacgcgctgactgtat |
26750243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 240 - 311
Target Start/End: Original strand, 32614288 - 32614359
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactg |
311 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||| ||| ||||||||||| ||||| ||||||| ||||||| |
|
|
| T |
32614288 |
ccagctgactgtgcatttttactgatgtgacatgatgcctcacctttttcggatgaggtggcgcgctgactg |
32614359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 121 - 178
Target Start/End: Original strand, 22056480 - 22056538
Alignment:
| Q |
121 |
ttgggttaataggtctttacc-ccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22056480 |
ttgggttaataggtctttaactccctgtaatatagggcacttttggttttgccccctgt |
22056538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 120 - 169
Target Start/End: Original strand, 13114395 - 13114444
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
13114395 |
tttgggttaataggtctttaccccctgtaatataggtcattttcggtttt |
13114444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 121 - 170
Target Start/End: Complemental strand, 23270268 - 23270219
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggttttg |
170 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
23270268 |
ttgggttaataggtctttaccccctttaatataggtcacttttgattttg |
23270219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 241 - 314
Target Start/End: Complemental strand, 25386477 - 25386404
Alignment:
| Q |
241 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||| |||||||||||||| ||| |||| |||||||||||| |||||||| || | |||||||||| |
|
|
| T |
25386477 |
cagctgactgtgtatttttgctgatgtagcacgttgtgtcacctttttcggatgacgttgcacgctgactgtat |
25386404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 33483695 - 33483752
Alignment:
| Q |
122 |
tgggttaataggtctttacc-ccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
33483695 |
tgggttaataggtctttaccaccctgtaatataggacacttttggttttgccctctgt |
33483752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 122 - 174
Target Start/End: Original strand, 10344049 - 10344101
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||||| |||| |
|
|
| T |
10344049 |
tgggttaataggtctttaccccctgtaatataggtcatttctggttttccccc |
10344101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 240 - 312
Target Start/End: Complemental strand, 12239841 - 12239769
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgt |
312 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | || |||||| |||||||||||||||||| |||||||| |
|
|
| T |
12239841 |
ccagctgactgtgcatttccgctgatgtggcacggtgagtcaccattttctgatgacgtggcgtgctgactgt |
12239769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 12322860 - 12322804
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||| ||||||||||||| |
|
|
| T |
12322860 |
gggttaataggtctttacccccctgtaatatagggcacttttgattttgccccctgt |
12322804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 243 - 311
Target Start/End: Complemental strand, 16130400 - 16130332
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactg |
311 |
Q |
| |
|
||||||||||||||||| | | ||||||||| |||||||||||||||||||| |||||| | ||||||| |
|
|
| T |
16130400 |
gctgactgtgcattttttcggttgtggcatgatgcgtcacctttttctgatgtcgtggcacgctgactg |
16130332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 250 - 314
Target Start/End: Complemental strand, 32614472 - 32614408
Alignment:
| Q |
250 |
gtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||| |||||||||||| ||| ||||||||||| ||||| ||||||| |||||||||| |
|
|
| T |
32614472 |
gtgcatttttgttgatgtggcatgatgcatcacctttttcggatgaggtggcgcgctgactgtat |
32614408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 122 - 169
Target Start/End: Original strand, 7922316 - 7922363
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
7922316 |
tgggttaataggtctttatcccctgtaatataggtcatttttggtttt |
7922363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 251 - 314
Target Start/End: Original strand, 26469132 - 26469195
Alignment:
| Q |
251 |
tgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| ||||||| ||| | |||||||||| |
|
|
| T |
26469132 |
tgcatttttgctgatgtggcatgctgcgtcaccttttttggatgacgaggcacgctgactgtat |
26469195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 29942500 - 29942449
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||| |||| |
|
|
| T |
29942500 |
gggttaataggtctttaccccctgtaatataggtcatttctggttttccccc |
29942449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 30409726 - 30409671
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| ||||||| |||| |||||||||||||||||||||| |||||||| |
|
|
| T |
30409726 |
gggttaataggcctttacctcctgcaatataggtcacttttggttttcccccctgt |
30409671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 31851758 - 31851813
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
31851758 |
gggttaataggtctttatcccctgtaatataggtcattttcggttttcccccctgt |
31851813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 127 - 178
Target Start/End: Original strand, 34762186 - 34762237
Alignment:
| Q |
127 |
taataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||| |||||| |
|
|
| T |
34762186 |
taataggtctttacctcctgtaatatagggcacttttggttttgctccctgt |
34762237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 14327481 - 14327559
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||| |||||| |||||||||||| |||||||||| |
|
|
| T |
14327481 |
tagaccagctgactgtatatttttgctgatgtggcatgccccgtcatcttttttggatgacgtggcgggctgactgtat |
14327559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 14420491 - 14420569
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||||| |||||| |||||||||||| |||||||||| |
|
|
| T |
14420491 |
tagaccagctgactgtatatttttgctgatgtggcatgccccgtcatcttttttggatgacgtggcgggctgactgtat |
14420569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 236 - 302
Target Start/End: Original strand, 16129567 - 16129633
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcg |
302 |
Q |
| |
|
||||| ||||||| |||||||||| || ||||||||| ||| |||||||||||||||||| |||||| |
|
|
| T |
16129567 |
tagacaagctgacagtgcatttttactaatgtggcatattgtgtcacctttttctgatgatgtggcg |
16129633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 22366275 - 22366229
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
22366275 |
gggttaataggtctttaccccctgcaatataggtcacttttgatttt |
22366229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 26644746 - 26644700
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
26644746 |
gggttaataggtcttttccccttgtaatataggtcacttttggtttt |
26644700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 26750712 - 26750666
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
26750712 |
gggttaataggtcttttccccttgtaatataggtcacttttggtttt |
26750666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 29453820 - 29453894
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | || ||||| ||||||||| | ||||||| |||||||||| |
|
|
| T |
29453820 |
ccagctgactgtgcattttcgctgatgtggcacgctgagtcacgattttctgataatgtggcgcgctgactgtat |
29453894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 121 - 178
Target Start/End: Original strand, 54805 - 54861
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
54805 |
ttgggttaataggtcttt-cctcctgtaatataggacacttttggttttgtcccctgt |
54861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 123 - 168
Target Start/End: Complemental strand, 3120391 - 3120346
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttt |
168 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
3120391 |
gggttaataggcctttaccccctgcaatataggtcacttttggttt |
3120346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 41 - 106
Target Start/End: Original strand, 13757547 - 13757612
Alignment:
| Q |
41 |
ctaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctat |
106 |
Q |
| |
|
|||||| ||||||||||||||| |||||| || |||| ||||||||||||||||| ||||| |||| |
|
|
| T |
13757547 |
ctaattcgtgagcgacctcattagtttgcttcttattaaactcaacatgagagttttgaaacctat |
13757612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 123 - 168
Target Start/End: Original strand, 16129494 - 16129539
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttt |
168 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
16129494 |
gggttaataagtctttaccccctgtaatatatgtcacttttggttt |
16129539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 65 - 106
Target Start/End: Original strand, 27862150 - 27862191
Alignment:
| Q |
65 |
tttgcctcctattgaactcaacatgagagttctgaaatctat |
106 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27862150 |
tttgcctcctgttgaactcaacatgagagttctgaaatctat |
27862191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 127 - 178
Target Start/End: Original strand, 3062194 - 3062246
Alignment:
| Q |
127 |
taataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||||||||| |||| |
|
|
| T |
3062194 |
taataggcctttacccctctgtaatataggtcacttttggttttgcccactgt |
3062246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 12321562 - 12321618
Alignment:
| Q |
123 |
gggttaataggtcttta-ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
12321562 |
gggttaataggtctttatccccctgtaatatagggtacttttggttttgcctcctgt |
12321618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 18984062 - 18984006
Alignment:
| Q |
123 |
gggttaataggtctttaccc-cctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||||| |||| |||||||||||||||||||||| |||||||| |
|
|
| T |
18984062 |
gggttaataggcctttaccctcctgcaatataggtcacttttggttttcccccctgt |
18984006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 120 - 156
Target Start/End: Complemental strand, 24387821 - 24387785
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggt |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24387821 |
tttgggttaataggtctttaccccctgtaatataggt |
24387785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 32614599 - 32614547
Alignment:
| Q |
123 |
gggttaataggtctttac-cccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||| |||||| ||||||||||||| |||||||||||||||||||| |
|
|
| T |
32614599 |
gggttaataggcctttacacccctgtaatatatgtcacttttggttttgcccc |
32614547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 12239962 - 12239903
Alignment:
| Q |
120 |
tttgggttaataggtctttac-cccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| |||||| |||||| ||||||||||||||| ||||||| |
|
|
| T |
12239962 |
tttgggttaataggtctttacccccctgcaatatatgtcacttttggttttctcccctgt |
12239903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 244 - 299
Target Start/End: Original strand, 22365952 - 22366007
Alignment:
| Q |
244 |
ctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtg |
299 |
Q |
| |
|
||||||||||||||| |||||||||||| | || |||||| ||||||||||||||| |
|
|
| T |
22365952 |
ctgactgtgcattttcgctgatgtggcacgctgagtcaccgttttctgatgacgtg |
22366007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 22573802 - 22573853
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||| ||||| |||| |
|
|
| T |
22573802 |
gggttaataggtctttaccccctataatataggtcattttttgtttttcccc |
22573853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 240 - 303
Target Start/End: Original strand, 30408703 - 30408766
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgc |
303 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || |||||| ||||| ||| |||| |||| |
|
|
| T |
30408703 |
ccagctgactgtgcattttcgctgatgtggcatgctgagtcaccattttcagataacgtagcgc |
30408766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 3593632 - 3593578
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||| |||| ||||| |||| |
|
|
| T |
3593632 |
tttgggttaataggtctttaccctctgtaatatatgtcattttttgtttttcccc |
3593578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 51 - 101
Target Start/End: Complemental strand, 4513127 - 4513077
Alignment:
| Q |
51 |
agcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaa |
101 |
Q |
| |
|
||||||| |||| | |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4513127 |
agcgaccccattggcttgcctcctattgaactcgacatgagagttctgaaa |
4513077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 24062167 - 24062213
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| || ||||||| |
|
|
| T |
24062167 |
gggttaataggtctttaccccctataatataggtcatttctggtttt |
24062213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 125 - 178
Target Start/End: Original strand, 24914440 - 24914494
Alignment:
| Q |
125 |
gttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| ||||||| |||||||||||| |||||||| ||||||||||||| |
|
|
| T |
24914440 |
gttaataggtcattacccccctgtaatataggacacttttgattttgccccctgt |
24914494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 65 - 106
Target Start/End: Original strand, 13104440 - 13104481
Alignment:
| Q |
65 |
tttgcctcctattgaactcaacatgagagttctgaaatctat |
106 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
13104440 |
tttgcctcttgttgaactcaacatgagagttctgaaatctat |
13104481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 178
Target Start/End: Complemental strand, 13114680 - 13114627
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| ||| |||||| | |||||| |
|
|
| T |
13114680 |
gttaataggtctttaccccctgtaatatatgtcattttcggttttcctccctgt |
13114627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 121 - 169
Target Start/End: Complemental strand, 25400837 - 25400788
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccc-tgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| ||| |||||| |
|
|
| T |
25400837 |
ttgggttaataggtctttacccccttgtaatataggtcattttcggtttt |
25400788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 121 - 178
Target Start/End: Original strand, 26469005 - 26469062
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||| |||||||| ||||||||| |||||||||| ||||||| ||||| |
|
|
| T |
26469005 |
ttgggttaataggcatttaccccttgtaatatatgtcacttttgattttgcctcctgt |
26469062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 20 - 112
Target Start/End: Complemental strand, 11657720 - 11657628
Alignment:
| Q |
20 |
gattagatagggttgtctaaactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctattaacta |
112 |
Q |
| |
|
|||||||||||| | |||| |||| | |||||| ||| ||| | |||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
11657720 |
gattagatagggctacctaagctaactcgtgagctaccctatttgcttgcctccggctgaactcaacatgagagttctgaaatctatcaacta |
11657628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 122 - 158
Target Start/End: Original strand, 13639508 - 13639544
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13639508 |
tgggttagtaggtctttaccccctgtaatataggtca |
13639544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 18982914 - 18982970
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||||||| || ||||||||||||||||||| || |||||||| |
|
|
| T |
18982914 |
gggttaataggcctttacccccctgcaatataggtcacttttggtgttcccccctgt |
18982970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 41 - 101
Target Start/End: Complemental strand, 19047152 - 19047092
Alignment:
| Q |
41 |
ctaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaa |
101 |
Q |
| |
|
|||||| |||||||||| |||| | |||||||||||| ||||| ||||||||||| ||||| |
|
|
| T |
19047152 |
ctaattcgtgagcgaccacattagcttgcctcctattaaactcgacatgagagttttgaaa |
19047092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 126 - 178
Target Start/End: Complemental strand, 20979799 - 20979747
Alignment:
| Q |
126 |
ttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||| || ||||||||||||||| || ||||||| |||||||| |
|
|
| T |
20979799 |
ttaataggtctttatccactgtaatataggtcatttctggttttcccccctgt |
20979747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 50 - 101
Target Start/End: Complemental strand, 942749 - 942698
Alignment:
| Q |
50 |
gagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaa |
101 |
Q |
| |
|
|||||||| |||| | |||||||||||||||||| |||| |||||||||||| |
|
|
| T |
942749 |
gagcgaccccattggcttgcctcctattgaactcgacattagagttctgaaa |
942698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 6000728 - 6000677
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||| |||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
6000728 |
gggttaatagagctttaccccctgtaatatagagcacttttggttttccccc |
6000677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 17441402 - 17441456
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| |||||| | |||||| |
|
|
| T |
17441402 |
gggttaataggtctttacccc-tgtaatataggtcattttcggttttacaccctgt |
17441456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 178
Target Start/End: Original strand, 19412402 - 19412445
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| |||||||| |
|
|
| T |
19412402 |
ctttaccccctgtaatataggttatttttggttttcccccctgt |
19412445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 20754630 - 20754575
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||| |||| ||||| ||||||| |
|
|
| T |
20754630 |
gggttaattggcctttaccccctgtaatataggtcattttttattttgtcccctgt |
20754575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 22365834 - 22365885
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
22365834 |
gggttaataggcctttacccccctcaatataggtcacttttggttttccccc |
22365885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 154
Target Start/End: Complemental strand, 22574087 - 22574056
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatatag |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
22574087 |
gggttaataggtctttaccccctgtaatatag |
22574056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 178
Target Start/End: Complemental strand, 29239746 - 29239703
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||| |||||||| |
|
|
| T |
29239746 |
ctttacccactgtaatataggtcatttttggtttttccccctgt |
29239703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 124 - 174
Target Start/End: Complemental strand, 31852049 - 31851998
Alignment:
| Q |
124 |
ggttaataggtctttaccccc-tgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||| |||||| |||| |
|
|
| T |
31852049 |
ggttaataggtctttacccccctgtaatataggtcattttcggttttccccc |
31851998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 140 - 178
Target Start/End: Complemental strand, 308598 - 308560
Alignment:
| Q |
140 |
ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
308598 |
ccccctgtaatataggtcatttttggttttcccccctgt |
308560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 124 - 173
Target Start/End: Complemental strand, 1438666 - 1438616
Alignment:
| Q |
124 |
ggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccc |
173 |
Q |
| |
|
||||||||||| |||||||| |||||||||| ||||||||| ||||||||| |
|
|
| T |
1438666 |
ggttaataggtttttacccctctgtaatataagtcactttttgttttgccc |
1438616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 120 - 174
Target Start/End: Complemental strand, 13357647 - 13357593
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||| ||| ||||||||||||| || ||||||||||||| |||||||||| |||| |
|
|
| T |
13357647 |
tttgagtttataggtctttacctccagtaatataggtcatttttggtttttcccc |
13357593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 167
Target Start/End: Complemental strand, 16130517 - 16130475
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggtt |
167 |
Q |
| |
|
||||||||||||||||||| | |||||||| |||||||||||| |
|
|
| T |
16130517 |
gttaataggtctttaccccttataatatagatcacttttggtt |
16130475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 140 - 178
Target Start/End: Complemental strand, 21226998 - 21226960
Alignment:
| Q |
140 |
ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
21226998 |
ccccctgtaatataggtcatttttggttttcccccctgt |
21226960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 121 - 178
Target Start/End: Complemental strand, 24602703 - 24602645
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| | |||||||||| |||||||||||||| |||||||||| |||||||| |
|
|
| T |
24602703 |
ttgggttaatggtgctttacccccatgtaatataggtcatttttggttttcccccctgt |
24602645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 26644087 - 26644132
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26644087 |
gggttaatagacctttacccc-tgtaatataggtcacttttggtttt |
26644132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 26750053 - 26750098
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
26750053 |
gggttaatagacctttacccc-tgtaatataggtcacttttggtttt |
26750098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 28583544 - 28583602
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||| ||||||||||||| ||||||| |
|
|
| T |
28583544 |
tttgggttaatagtgttttaccccgtgtaatatagggcacttttggtttttgcccctgt |
28583602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 29454773 - 29454718
Alignment:
| Q |
123 |
gggttaataggtctttacccc----ctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||||||||| |||| |
|
|
| T |
29454773 |
gggttaataggtctttacccctgcactgtaatataggtcccttttggttttccccc |
29454718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 136 - 174
Target Start/End: Original strand, 30408601 - 30408639
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
30408601 |
tttaccccctgcaatataggtcacttttggttttccccc |
30408639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 177
Target Start/End: Original strand, 32614172 - 32614226
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctg |
177 |
Q |
| |
|
||||||||||| |||||||| |||||||||||| |||||| | ||||| |||||| |
|
|
| T |
32614172 |
gggttaataggcctttaccctctgtaatataggccactttcgattttgtcccctg |
32614226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 140 - 178
Target Start/End: Complemental strand, 33485115 - 33485077
Alignment:
| Q |
140 |
ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
33485115 |
ccccctgtaatatagggtacttttggttttgccccctgt |
33485077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 178
Target Start/End: Original strand, 2741566 - 2741603
Alignment:
| Q |
141 |
cccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
2741566 |
cccctttaatatagatcacttttggttttgccccctgt |
2741603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 124 - 169
Target Start/End: Original strand, 5953163 - 5953207
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| || ||||||| |
|
|
| T |
5953163 |
ggttaataggtctttacccc-tgtaatataggtcatttctggtttt |
5953207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 120 - 169
Target Start/End: Original strand, 7313448 - 7313497
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||| |||| ||||| |
|
|
| T |
7313448 |
tttgggttaatggtgctttaccccctgtaatataggtcattttttgtttt |
7313497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 301
Target Start/End: Original strand, 18983034 - 18983095
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggc |
301 |
Q |
| |
|
||||||||||||||||||| |||||||||||| || ||| || ||||||||||| ||||| |
|
|
| T |
18983034 |
ccagctgactgtgcattttcgctgatgtggcacactgagtcgccattttctgatgatgtggc |
18983095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 124 - 169
Target Start/End: Original strand, 30381567 - 30381612
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| | ||| |||||| |
|
|
| T |
30381567 |
ggttaataggtctttatcccctgtaatataggttattttcggtttt |
30381612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 77 - 106
Target Start/End: Complemental strand, 32899932 - 32899903
Alignment:
| Q |
77 |
tgaactcaacatgagagttctgaaatctat |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
32899932 |
tgaactcaacatgagagttctgaaatctat |
32899903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 121 - 174
Target Start/End: Complemental strand, 33352674 - 33352621
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||| |||| ||||| |||| |
|
|
| T |
33352674 |
ttgggttaatggtgctttaccccctgtaatataggtcattttttgttttccccc |
33352621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 122 - 158
Target Start/End: Original strand, 5334642 - 5334678
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
5334642 |
tgggttaataggtttttaccccctgtaatataagtca |
5334678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 122 - 174
Target Start/End: Complemental strand, 7017356 - 7017304
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||| |||| ||||| |||| |
|
|
| T |
7017356 |
tgggttaatggtgctttaccccctgtaatataggtcattttttgttttccccc |
7017304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 236 - 264
Target Start/End: Complemental strand, 23270154 - 23270126
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctga |
264 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23270154 |
tagaccagctgactgtgcatttttgctga |
23270126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 120 - 176
Target Start/End: Original strand, 31116476 - 31116532
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
|||| ||||||||||||||||||||| |||||||| ||| ||| | |||| |||||| |
|
|
| T |
31116476 |
tttgagttaataggtctttaccccctctaatatagatcattttcgattttcccccct |
31116532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 33751980 - 33751944
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33751980 |
gggttaataggtctttacccctctgtaatataggtca |
33751944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 124 - 156
Target Start/End: Complemental strand, 34715960 - 34715928
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggt |
156 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
34715960 |
ggttaatagttctttaccccctgtaatataggt |
34715928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 73; Significance: 3e-33; HSPs: 112)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 73; E-Value: 3e-33
Query Start/End: Original strand, 124 - 314
Target Start/End: Original strand, 34901503 - 34901693
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnnttt-attcggtccttgtnnnnnnnttttgtttt |
222 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||| |
|
|
| T |
34901503 |
ggttaataggcttttaccccctgtaatataggtcacttttggttttgccccctgtaaaaatatttttttggattcggtccttgtaaattttttttgtttt |
34901602 |
T |
 |
| Q |
223 |
agaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
34901603 |
ggaaaacccccc-tagaccagctgactgtgcatttttgctgatgtggcatgctgcgtcacctttttcggatgacgtggcgcgctgactgtat |
34901693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 111 - 314
Target Start/End: Complemental strand, 31986299 - 31986096
Alignment:
| Q |
111 |
taataattgtttgggttaataggtctttaccccc--tgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnntttattcggtccttgtnn |
208 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| || | ||||||||||| |
|
|
| T |
31986299 |
taataatcttttgggttaataggtctttaccccccgtgtaatataggtcacttttagttttgccccctgtaaaaaaaaaaa-ttgaatcggtccttgtaa |
31986201 |
T |
 |
| Q |
209 |
nnnnnttttgttttagaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactga |
308 |
Q |
| |
|
||||||||| ||||| ||||| |||||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||| |||| |
|
|
| T |
31986200 |
tatttttttgttttggaaaacccccc-tagactagctgactgtgcatttttgctgatgtggcatgctccgtcacctttttcggatgacgtggcgcgctga |
31986102 |
T |
 |
| Q |
309 |
ctgtat |
314 |
Q |
| |
|
|||||| |
|
|
| T |
31986101 |
ctgtat |
31986096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 39515063 - 39514985
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||| ||||||| ||||||||||||| |||||||||| |
|
|
| T |
39515063 |
tagaccagctgactgtgcatttttgctgatgtggcatgctgcgtcatctttttcagatgacgtggcgcgctgactgtat |
39514985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 34902681 - 34902603
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| |||||||||| |
|
|
| T |
34902681 |
tagaccaactgactgtgcatttttgctgatgtggcatgttgcgtcactttttttggatgacgtggcgcgctgactgtat |
34902603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 112 - 178
Target Start/End: Complemental strand, 2270359 - 2270293
Alignment:
| Q |
112 |
aataattgtttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||| || |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2270359 |
aataaatgattgggttaataggtctttaccccctgtattataggtcacttttggttttgccccctgt |
2270293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 314
Target Start/End: Original strand, 31985011 - 31985204
Alignment:
| Q |
123 |
gggttaataggtctttacc-ccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnnttt--attcggtccttgtnnnnnnnttttgt |
219 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | ||| ||||||||||||| |||||| |
|
|
| T |
31985011 |
gggttaataggtctttacctccctgtaatataggtcacttttggttttgccccctataatttttattttttttgattcggtccttgtaaaatgtttttgt |
31985110 |
T |
 |
| Q |
220 |
tttagaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||| ||||| || || ||||||||||||||||||| |||||||||||| | | ||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
31985111 |
tttggaaaacccccc-taaacaagctgactgtgcatttttgttgatgtggcatgctccatcacctttttcggatgacgtggcgcgctgactgtat |
31985204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 243 - 314
Target Start/End: Original strand, 34374348 - 34374419
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||| |||||||||| |||| ||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34374348 |
gctgactgtacatttttgcttatgttgcatgatgcgtcacctttttctgatgacgtggcgcgctgactgtat |
34374419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 243 - 314
Target Start/End: Original strand, 39451624 - 39451695
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||| | |||||||||| |||||||||| |
|
|
| T |
39451624 |
gctgactgtgcatttttgcttatgtggcatgatgcgtcacctttttctaacgacgtggcgcgctgactgtat |
39451695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 123 - 314
Target Start/End: Original strand, 39513867 - 39514055
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnntttattcggtccttgtnnnnnnnttttgtttt |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||| ||||||||| |
|
|
| T |
39513867 |
gggttaataggcatttaccccctgtaatataggtcacttttggttttgccccctgt-aaaaaaaaaattggattcggtccttgtaaaatatttttgtttt |
39513965 |
T |
 |
| Q |
223 |
agaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||| |||||||||| ||||| | ||||||||||||||||||| |||||||||||||| ||||| ||||||| |||||||||| |
|
|
| T |
39513966 |
ggaaaa--ccccctagaccagcttactgtacttttttgctgatgtggcatgctgcgtcaccttttttggatgatgtggcgcgctgactgtat |
39514055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 27164714 - 27164660
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27164714 |
ggttaataggtctttaccccctgtaatatagggcacttttggttttgccccctgt |
27164660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 40702067 - 40702012
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
40702067 |
gggttaataggcctttaccccctgtaatataggtcacttttcgttttgccccctgt |
40702012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 236 - 310
Target Start/End: Original strand, 2269156 - 2269230
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgact |
310 |
Q |
| |
|
|||| ||||||||||||||||| |||||||||||||| ||| |||||||||||| ||||||||||| ||||||| |
|
|
| T |
2269156 |
tagatcagctgactgtgcatttatgctgatgtggcattttgtgtcacctttttcggatgacgtggcatactgact |
2269230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 240 - 314
Target Start/End: Complemental strand, 6820022 - 6819948
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| || ||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
6820022 |
ccagctgactgtgcattttcgctgatgtggcatgctgagtcactgttttctgatgacgtggcacgctgactgtat |
6819948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 39808646 - 39808703
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
39808646 |
tttgggttaataggtctttacccc-tgtaatatagggcacttttggttttgccccctgt |
39808703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 1600077 - 1600130
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||| | |||||||||||||||||||| |
|
|
| T |
1600077 |
gggttaataggtctttaccccctgtaatataagccacttttggttttgccccct |
1600130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 241 - 314
Target Start/End: Original strand, 37402603 - 37402676
Alignment:
| Q |
241 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | || |||||| |||||| |||||||||||| |||||||||| |
|
|
| T |
37402603 |
cagctgactgtgcattttcgctgatgtggcacgctgagtcaccattttctaatgacgtggcgcgctgactgtat |
37402676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 42348960 - 42349017
Alignment:
| Q |
122 |
tgggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
42348960 |
tgggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
42349017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 39810144 - 39810088
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
39810144 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
39810088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 249 - 300
Target Start/End: Complemental strand, 34375067 - 34375016
Alignment:
| Q |
249 |
tgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtgg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
34375067 |
tgtgcatttttgctgatgtggcatgttgtgtcaccttttcctgatgacgtgg |
34375016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 247 - 314
Target Start/End: Complemental strand, 39452282 - 39452215
Alignment:
| Q |
247 |
actgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||| || || || |||||||||||||||||||| |||| ||||| |
|
|
| T |
39452282 |
actgtgcatttttgctgatgtggcatgatgtgttacatttttctgatgacgtggcgcgctgaatgtat |
39452215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 120 - 173
Target Start/End: Original strand, 2269039 - 2269093
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccct-gtaatataggtcacttttggttttgccc |
173 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
2269039 |
tttgggttaataggtctttacctccttgtaatataggtcacttttggttttgccc |
2269093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 6819313 - 6819387
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | || ||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
6819313 |
ccagctgactgtgcattttcgctgatgtggcacgctgaatcaccgttttctgatgacgtggcacgctgactgtat |
6819387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 35009150 - 35009224
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | | || ||| ||||||||||||||||||| |||||||||| |
|
|
| T |
35009150 |
ccagctgactgtgcattttcgctgatgtggcacgcagagttaccgttttctgatgacgtggcgcgctgactgtat |
35009224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 35322414 - 35322336
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||| |||||||||| ||||| ||||| |||||||||| |
|
|
| T |
35322414 |
tagaccagctgactgtgcttttttgctgatgtggcatgatgcctcaccttttttggatgaggtggcatgctgactgtat |
35322336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 43945166 - 43945224
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| ||| |||||| |||||||| |
|
|
| T |
43945166 |
tttgggttaataggtctttaccccctgtaatatatgtcattttcggtttttccccctgt |
43945224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 241 - 314
Target Start/End: Complemental strand, 28223669 - 28223596
Alignment:
| Q |
241 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | || ||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
28223669 |
cagctgactgtgcattttcgctgatgtggcacgctgaatcaccattttctgatgacgtggcacgctgactgtat |
28223596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 241 - 302
Target Start/End: Complemental strand, 34504122 - 34504062
Alignment:
| Q |
241 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcg |
302 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
34504122 |
cagctgactgtgcatttccgctgatgtggcatgttgtgtcacc-ttttctgatgacgtggcg |
34504062 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 27163116 - 27163172
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||| ||||||| |
|
|
| T |
27163116 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttggcccctgt |
27163172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 242 - 314
Target Start/End: Original strand, 28222837 - 28222909
Alignment:
| Q |
242 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||| | ||| |||||||||||| | || |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
28222837 |
agctgactgtgtactttcgctgatgtggcacgctgagtcacctttttctgatgacgtgacgcgctgactgtat |
28222909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 14329657 - 14329602
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||| | |||||| |
|
|
| T |
14329657 |
gggttaataggtctttaccccctgtaatataggtcattttcggttttcctccctgt |
14329602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 29309565 - 29309620
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||| |||||||| |
|
|
| T |
29309565 |
gggttaataggtctttaccccctgtaatataggtcatttccggttttcccccctgt |
29309620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 39515179 - 39515124
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39515179 |
gggttaataggcctttactccctgtaatataggtcacttttggtttgaccccctgt |
39515124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 2270234 - 2270157
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | | |||||||| | ||||||||| | | |||||||||| |
|
|
| T |
2270234 |
tagaccagctgactgtgcatttttgctgatgtggcatgcttc-tcacctttgttggatgacgtgacacgctgactgtat |
2270157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 244 - 314
Target Start/End: Original strand, 27407492 - 27407562
Alignment:
| Q |
244 |
ctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||| | ||||| |||||| |||||| |||||| | |||||||| |
|
|
| T |
27407492 |
ctgactgtgcatttttgctgatgtggcatgccgtgtcacttttttcagatgacatggcgcgcagactgtat |
27407562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 120 - 158
Target Start/End: Complemental strand, 27543685 - 27543647
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27543685 |
tttgggttaataggtctttaccccctgtaatataggtca |
27543647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 34985379 - 34985333
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
34985379 |
gggttaataggtctttaccccctgtaatataggtcatttctggtttt |
34985333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 37402484 - 37402537
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
||||||||| | |||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
37402484 |
gggttaataagcctttaccccctgcaatataggtcacttttggttttcccccct |
37402537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 122 - 158
Target Start/End: Complemental strand, 960555 - 960519
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
960555 |
tgggttaataggtctttaccccctgtaatataggtca |
960519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 6819195 - 6819251
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||||||| || |||||||||||||||||||||| |||||||| |
|
|
| T |
6819195 |
gggttaataggcctttacccccctgcaatataggtcacttttggttttcccccctgt |
6819251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 240 - 312
Target Start/End: Original strand, 34503338 - 34503410
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgt |
312 |
Q |
| |
|
|||||||||| |||||||||||||| |||||| | || ||||||||||||| ||||| |||| | |||||||| |
|
|
| T |
34503338 |
ccagctgactatgcatttttgctgacgtggcacgctgagtcacctttttctaatgacatggcacgctgactgt |
34503410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 42350235 - 42350179
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| || ||||||||||||||||||| |
|
|
| T |
42350235 |
gggttaataggtctttacccccctgtaatatagagcatttttggttttgccccctgt |
42350179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 3912537 - 3912486
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||| |||||| |||| |
|
|
| T |
3912537 |
gggttaataagtctttaccccctgtaatataggtcattttcggttttccccc |
3912486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 5873687 - 5873738
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||| ||||| |||||| |||||||||||||||||||||| |||| |
|
|
| T |
5873687 |
gggttaatagggctttaacccctgcaatataggtcacttttggttttccccc |
5873738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 54 - 109
Target Start/End: Original strand, 11911423 - 11911478
Alignment:
| Q |
54 |
gacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctattaa |
109 |
Q |
| |
|
|||| ||||||||| ||||||||||||||| ||||||||||| ||||| ||||||| |
|
|
| T |
11911423 |
gaccccattcgtttacctcctattgaactcgacatgagagttttgaaaactattaa |
11911478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 12330333 - 12330388
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| | || | ||||| |||||||| |
|
|
| T |
12330333 |
gggttaataggtctttaccccctgtaatataggttatttctagtttttccccctgt |
12330388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 25277763 - 25277728
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
25277763 |
gggttaataggtctttaccccctgtaatataggtca |
25277728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 25653704 - 25653759
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
25653704 |
gggttaatagtgttttaccccctgtaatataggtcatttttggttttcccccctgt |
25653759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 9 - 112
Target Start/End: Original strand, 26951454 - 26951557
Alignment:
| Q |
9 |
atggggactatgattagatagggttgtctaaactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctatta |
108 |
Q |
| |
|
|||||| ||| |||||||||||| || || | |||| | |||||| ||| ||| | |||||||| |||||||||||||||||||||||||||||| | |
|
|
| T |
26951454 |
atgggggctaggattagatagggctgcctgagctaactcgtgagctaccctatttgcttgcctccggctgaactcaacatgagagttctgaaatctatca |
26951553 |
T |
 |
| Q |
109 |
acta |
112 |
Q |
| |
|
|||| |
|
|
| T |
26951554 |
acta |
26951557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 27198144 - 27198199
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||| |||||| || ||||| |
|
|
| T |
27198144 |
gggttaataggtctttatcccctgtaatataggtcattttcggttttccctcctgt |
27198199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 27987297 - 27987348
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||| |||||| |||| |
|
|
| T |
27987297 |
gggttaataggtctttaccccctataatataggtcattttcggttttccccc |
27987348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 28044599 - 28044650
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||| |||||| |||| |
|
|
| T |
28044599 |
gggttaataggtctttaccccctataatataggtcattttcggttttccccc |
28044650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 135 - 178
Target Start/End: Complemental strand, 31343647 - 31343604
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
31343647 |
ctttaccccatgtaatataggtcacttttggttttcccccctgt |
31343604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 135 - 178
Target Start/End: Original strand, 41708840 - 41708883
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
41708840 |
ctttaccccctgtaatataggtcatttttggtttttccccctgt |
41708883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 1601673 - 1601727
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
1601673 |
gggttaatagacctttacccctctgtaatatagggcacttttggttttgccccct |
1601727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 27987583 - 27987537
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| || ||||||| |
|
|
| T |
27987583 |
gggttaataggtctttaccccctgtaatatagatcatttctggtttt |
27987537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 28044885 - 28044839
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| || ||||||| |
|
|
| T |
28044885 |
gggttaataggtctttaccccctgtaatatagatcatttctggtttt |
28044839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 35862793 - 35862747
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||| |||||||||||| ||||||| |||||||||||||| |
|
|
| T |
35862793 |
gggttaataggcctttaccccctgcaatatagatcacttttggtttt |
35862747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 124 - 174
Target Start/End: Complemental strand, 40411455 - 40411405
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| ||| |||||| |||| |
|
|
| T |
40411455 |
ggttaataggtctttaccccctgcaatataggtcattttaggtttttcccc |
40411405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 43400671 - 43400717
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| || ||||||| |
|
|
| T |
43400671 |
gggttaataggtctttaccccctgtaatatatgtcatttctggtttt |
43400717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 122 - 174
Target Start/End: Complemental strand, 34504233 - 34504183
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||| ||||||||| ||||||||||||||| |||| |
|
|
| T |
34504233 |
tgggttaataggtctttaccc--tgtaatatatgtcacttttggtttttcccc |
34504183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 123 - 168
Target Start/End: Complemental strand, 35010001 - 35009956
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttt |
168 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||||| |||||| |
|
|
| T |
35010001 |
gggttaatatgtctttaccccctgcaatataggtcacttgtggttt |
35009956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 242 - 310
Target Start/End: Complemental strand, 37125338 - 37125269
Alignment:
| Q |
242 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttct-gatgacgtggcgcactgact |
310 |
Q |
| |
|
|||||||||||||||| |||||||||||| | |||||||||||||| | ||||| ||||||| |||||| |
|
|
| T |
37125338 |
agctgactgtgcatttacgctgatgtggcacgctgcgtcacctttttttggatgatgtggcgcgctgact |
37125269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 158
Target Start/End: Original strand, 40652621 - 40652654
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40652621 |
gttaataggtctttaccccctgtaatataggtca |
40652654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 18367025 - 18367081
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
18367025 |
tgggttaatggtgctttaccccctgtaatataggtcattttcggttttcccccctgt |
18367081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 27543411 - 27543463
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| ||| |||||| |||| |
|
|
| T |
27543411 |
gggttaataggtctttacccccctgtaatataggtcattttcggttttccccc |
27543463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 124 - 168
Target Start/End: Original strand, 28561435 - 28561479
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttt |
168 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
28561435 |
ggttaatagagctttaccccctgtaatatagggcacttttggttt |
28561479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 124 - 168
Target Start/End: Original strand, 28566933 - 28566977
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttt |
168 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
28566933 |
ggttaatagagctttaccccctgtaatatagggcacttttggttt |
28566977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 28575169 - 28575117
Alignment:
| Q |
123 |
gggttaataggtctttacc-ccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||| ||||||| |||||||||||||| ||||||||||||| |||| |
|
|
| T |
28575169 |
gggttaataggactttaccaccctgtaatatagggcacttttggttttccccc |
28575117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 175
Target Start/End: Complemental strand, 29309831 - 29309779
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccc |
175 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| || |||||| ||||| |
|
|
| T |
29309831 |
gggttaataggtttttaccccctgtaatataggtcatttccggttttcccccc |
29309779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 37403517 - 37403461
Alignment:
| Q |
123 |
gggttaataggtctttacc-ccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||| ||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
37403517 |
gggttaataggcatttacctccctgcaatataggtcacttttggttttcccccctgt |
37403461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 9513828 - 9513863
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| |
|
|
| T |
9513828 |
gggttaatatgtctttaccccctgtaatataggtca |
9513863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 178
Target Start/End: Complemental strand, 15152334 - 15152291
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| |||||||| |
|
|
| T |
15152334 |
ctttaccccctgtaatataggtcattttttgttttcccccctgt |
15152291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 178
Target Start/End: Original strand, 19157942 - 19157985
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||| |||||||| |
|
|
| T |
19157942 |
ctttaccccctgttatataggtcatttttggttttcccccctgt |
19157985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 174
Target Start/End: Complemental strand, 21692650 - 21692611
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
21692650 |
ctttaccccctgtaatataggtcatttttggttttccccc |
21692611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 178
Target Start/End: Original strand, 22686755 - 22686798
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| |||||||| |
|
|
| T |
22686755 |
ctttaccccctgtaatataggtcattttttgtttttccccctgt |
22686798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 30222144 - 30222093
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||| |||||| |||| |
|
|
| T |
30222144 |
gggttaatagtgctttaccccctgtaatataggtcattttcggttttccccc |
30222093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 31974660 - 31974715
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| ||||||| ||||||||||| |||| |||||||||| |||||||| |
|
|
| T |
31974660 |
gggttaatagtgctttacctcctgtaatataagtcatttttggttttcccccctgt |
31974715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 39451505 - 39451560
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||| |||||||||| ||||||| |||| |||||||||| | |||||| |
|
|
| T |
39451505 |
gggttaataggtttttaccccctctaatataagtcatttttggttttcctccctgt |
39451560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 40652710 - 40652660
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| || ||||||| |||| |
|
|
| T |
40652710 |
gggttaataggtctttacccc-tgtaatataggtcatttctggttttccccc |
40652660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 124 - 174
Target Start/End: Original strand, 40701347 - 40701398
Alignment:
| Q |
124 |
ggttaataggtctttacc-ccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||| | ||||||||| |
|
|
| T |
40701347 |
ggttaacaggtctttaccgccctgtaatataggtcactttcgtttttgcccc |
40701398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 4105336 - 4105291
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||| ||||| |
|
|
| T |
4105336 |
gggttaataggtctttacccc-tgtaatataggtcattttttgtttt |
4105291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 59 - 101
Target Start/End: Complemental strand, 7251153 - 7251111
Alignment:
| Q |
59 |
cattcgtttgcctcctattgaactcaacatgagagttctgaaa |
101 |
Q |
| |
|
|||| |||||||||||||||||||| |||| |||||||||||| |
|
|
| T |
7251153 |
cattggtttgcctcctattgaactcgacataagagttctgaaa |
7251111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 126 - 156
Target Start/End: Original strand, 8388117 - 8388147
Alignment:
| Q |
126 |
ttaataggtctttaccccctgtaatataggt |
156 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8388117 |
ttaataggtctttaccccctgtaatataggt |
8388147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 140 - 178
Target Start/End: Complemental strand, 9768344 - 9768306
Alignment:
| Q |
140 |
ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
9768344 |
ccccctgtaatataggtcacttttgattttgtcccctgt |
9768306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 117 - 158
Target Start/End: Complemental strand, 10710806 - 10710764
Alignment:
| Q |
117 |
ttgtttgggttaataggtctttac-cccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
10710806 |
ttgtttgggttaataggtctttacacccttgtaatataggtca |
10710764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 140 - 178
Target Start/End: Complemental strand, 11424376 - 11424338
Alignment:
| Q |
140 |
ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
11424376 |
ccccctgtaatataggtcatttttggttttcccccctgt |
11424338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 140 - 178
Target Start/End: Complemental strand, 20076424 - 20076386
Alignment:
| Q |
140 |
ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
20076424 |
ccccctgtaatataggtcatttttggttttcccccctgt |
20076386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 157
Target Start/End: Complemental strand, 25602004 - 25601970
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtc |
157 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
25602004 |
gggttaataggtctttaccccatgtaatataggtc |
25601970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 49 - 107
Target Start/End: Complemental strand, 26440863 - 26440805
Alignment:
| Q |
49 |
tgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctatt |
107 |
Q |
| |
|
||||| ||| |||| | |||||||||||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
26440863 |
tgagcaaccccattagcttgcctcctattgaactcgacatgagagttctaaaaactatt |
26440805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 126 - 176
Target Start/End: Complemental strand, 34375186 - 34375136
Alignment:
| Q |
126 |
ttaataggtctttaccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
||||||| |||||||||||||||||||| ||||||||| |||| |||||| |
|
|
| T |
34375186 |
ttaatagccctttaccccctgtaatatagatcacttttgattttcccccct |
34375136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 34503222 - 34503268
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| ||||||||| ||||| |
|
|
| T |
34503222 |
gggttaatatgtctttaccccctctaatatatgtcactttttgtttt |
34503268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 125 - 178
Target Start/End: Complemental strand, 34902793 - 34902739
Alignment:
| Q |
125 |
gttaataggtctttac-cccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||| ||||| |||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
34902793 |
gttaataggcatttacacccctgtaatataggttacttttggttttcccccctgt |
34902739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 124 - 169
Target Start/End: Original strand, 2696455 - 2696500
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||| || ||||||| |
|
|
| T |
2696455 |
ggttaataggtctttaccccttgtaatatagatcatttctggtttt |
2696500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 121 - 174
Target Start/End: Original strand, 3785523 - 3785576
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||| |||| ||||| |||| |
|
|
| T |
3785523 |
ttgggttaatggtgctttaccccctgtaatataggtcattttttgttttccccc |
3785576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 121 - 169
Target Start/End: Original strand, 16093606 - 16093655
Alignment:
| Q |
121 |
ttgggttaataggtctttac-cccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||||| |||| ||||| |
|
|
| T |
16093606 |
ttgggttaataggtctttacacccttgtaatataggtcattttttgtttt |
16093655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 120 - 169
Target Start/End: Original strand, 29726103 - 29726152
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||| ||||||||| |||||||| |||||||||||||| || ||||||| |
|
|
| T |
29726103 |
tttggattaataggtttttaccccatgtaatataggtcatttctggtttt |
29726152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 178
Target Start/End: Complemental strand, 35077987 - 35077934
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||| | |||||| |||||||||||||||| |||||||||| ||| |||| |
|
|
| T |
35077987 |
gttaatagctatttacctcctgtaatataggtcatttttggttttcccctctgt |
35077934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 178
Target Start/End: Complemental strand, 35322519 - 35322466
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||| |||| |||||||||||||| ||||||||||||||| || |||| |
|
|
| T |
35322519 |
gttaataggcttttatcccctgtaatatagatcacttttggttttgtccactgt |
35322466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 124 - 169
Target Start/End: Complemental strand, 38500569 - 38500525
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| ||| |||||| |
|
|
| T |
38500569 |
ggttaataggtctttacccc-tgtaatataggtcattttcggtttt |
38500525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 124 - 169
Target Start/End: Complemental strand, 43400957 - 43400912
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||| || |||||||||||| ||| |||||| |
|
|
| T |
43400957 |
ggttaataggtctttaccctctctaatataggtcattttcggtttt |
43400912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 123 - 168
Target Start/End: Complemental strand, 43945441 - 43945397
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttt |
168 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| || |||||| |
|
|
| T |
43945441 |
gggttaataggtcttta-cccctgtaatataggtcatttctggttt |
43945397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 1601311 - 1601259
Alignment:
| Q |
123 |
gggttaataggtcttta-ccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||| ||||| |||||| ||||||||| |||||||| ||||||||| |
|
|
| T |
1601311 |
gggttaataggcctttacccccctctaatataggacacttttgattttgcccc |
1601259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 6105554 - 6105610
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||||| || |||||||| ||||||||||||||| |||||| |
|
|
| T |
6105554 |
tgggttaatagtgttttaccccgtgcaatataggacacttttggttttgctccctgt |
6105610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 7 - 115
Target Start/End: Original strand, 9808728 - 9808836
Alignment:
| Q |
7 |
atatggggactatgattagatagggttgtctaaactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctat |
106 |
Q |
| |
|
|||||||| || |||| ||||| | ||||| | |||| | ||||||||| ||||| ||||||| |||||||| |||||||||| |||||||||| |
|
|
| T |
9808728 |
atatgggggttaggattggatagagctgtctgagctaactcgtgagcgactccattcatttgccttaagttgaactcggcatgagagttttgaaatctat |
9808827 |
T |
 |
| Q |
107 |
taactaata |
115 |
Q |
| |
|
||||||||| |
|
|
| T |
9808828 |
taactaata |
9808836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 69 - 101
Target Start/End: Complemental strand, 18481270 - 18481238
Alignment:
| Q |
69 |
cctcctattgaactcaacatgagagttctgaaa |
101 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
18481270 |
cctcctattgaactcgacatgagagttctgaaa |
18481238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 240 - 288
Target Start/End: Complemental strand, 27408592 - 27408544
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcaccttttt |
288 |
Q |
| |
|
|||||||||||||||||||||||||| || |||| ||| |||| ||||| |
|
|
| T |
27408592 |
ccagctgactgtgcatttttgctgatttgacatgctgcatcactttttt |
27408544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 140 - 176
Target Start/End: Original strand, 31343382 - 31343418
Alignment:
| Q |
140 |
ccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
31343382 |
ccccctgtaatataggtcatttttggttttcccccct |
31343418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 127 - 163
Target Start/End: Complemental strand, 34019177 - 34019141
Alignment:
| Q |
127 |
taataggtctttaccccctgtaatataggtcactttt |
163 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||| |
|
|
| T |
34019177 |
taataggtctttatcccctgtaatataggtcattttt |
34019141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 125 - 169
Target Start/End: Original strand, 34374231 - 34374274
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| ||||| |||| |
|
|
| T |
34374231 |
gttaataggtctttacccc-tgtaatataggtcaattttgatttt |
34374274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 121 - 157
Target Start/End: Complemental strand, 37403554 - 37403518
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtc |
157 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
37403554 |
ttgggttaataggcctttaccccctgcaatataggtc |
37403518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 41565270 - 41565326
Alignment:
| Q |
123 |
gggttaataggtcttta-ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||| ||| | |||||||||||| |
|
|
| T |
41565270 |
gggttaataggtctttacccccctgtaatatatgtcattttcgagtttgccccctgt |
41565326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 43978565 - 43978601
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43978565 |
gggttaataggtctttacccccgtgtaatataggtca |
43978601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 71; Significance: 4e-32; HSPs: 120)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 32145876 - 32145798
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
32145876 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttcagatgacgtggcgccctgactgtat |
32145798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 6e-31
Query Start/End: Original strand, 123 - 314
Target Start/End: Complemental strand, 9751733 - 9751543
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnntttattcggtccttgtnnnnnnnttttgtttt |
222 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||| |
|
|
| T |
9751733 |
gggttaataggcttttaccccctgtaatataggtcacttttggttttgccccctgtaaatttttttttttgattcggtccttgtaaaatttttttgtttt |
9751634 |
T |
 |
| Q |
223 |
agaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||| | |||| ||||||||||||| |||||||||| |
|
|
| T |
9751633 |
ggaaaacccccc-tagaccagctgactgtgcatttttgctgatgtggcatgttgtgtcagcctttttggatgacgtggcgcgctgactgtat |
9751543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 9750560 - 9750638
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||| |||||||||| |
|
|
| T |
9750560 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttcggatgacatggcgcgctgactgtat |
9750638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 56; E-Value: 4e-23
Query Start/End: Original strand, 236 - 303
Target Start/End: Complemental strand, 19601211 - 19601144
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgc |
303 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
19601211 |
tagaccagctgactgtgcatttttgttgatgtggcatgatgcgtcacctttttcggatgacgtggcgc |
19601144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 28820500 - 28820422
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| |||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
28820500 |
tagaccagctgacggtgcatttttgctgatgtggcatgttgtgtcaccctttttggatgacgtggcgcgctgactgtat |
28820422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 241 - 314
Target Start/End: Original strand, 32144980 - 32145053
Alignment:
| Q |
241 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||| |||||||||| || |||||||||| |
|
|
| T |
32144980 |
cagctgactgtgcatttttgctgatgtggcatgctgtgtcacctttttcggatgacgtggtgcgctgactgtat |
32145053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 120 - 314
Target Start/End: Original strand, 35599309 - 35599504
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnnttt-attcggtccttgtnnnnnnntttt |
217 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| || ||||||||||||| |||| |
|
|
| T |
35599309 |
tttgggttaatagacctttacccccctgtaatataggtcacttttggttttgccccctgtaaaaaaaaaaatttagattcggtccttgtaattttttttt |
35599408 |
T |
 |
| Q |
218 |
gttttagaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||| ||||| |||||||||||||||||||||||| ||||||||||||| | |||||||||||| |||||||||||| |||||||||| |
|
|
| T |
35599409 |
gttttggaaaacccccc-tagaccagctgactgtgcattttttctgatgtggcatgctccgtcaccttttttggatgacgtggcgggctgactgtat |
35599504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 242 - 314
Target Start/End: Complemental strand, 4602945 - 4602873
Alignment:
| Q |
242 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||| ||||||||||||| |||||||||| |
|
|
| T |
4602945 |
agctgactgtgcatttttgctgatgtggcatgttgcatcatcttttttggatgacgtggcgcgctgactgtat |
4602873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 242 - 314
Target Start/End: Complemental strand, 23932394 - 23932322
Alignment:
| Q |
242 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||| |||||||||||||| || |||||| ||||||||||||||||||| |||||||||| |
|
|
| T |
23932394 |
agctgactgtgcattttcgctgatgtggcatgctgagtcaccgttttctgatgacgtggcgcgctgactgtat |
23932322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 124 - 314
Target Start/End: Original strand, 28819537 - 28819727
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnntt-tattcggtccttgtnnnnnnnttttgtttt |
222 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||||| |
|
|
| T |
28819537 |
ggttaataggcctttaccccctgtaatataggtcacttttggttttgccccctgtaaaaaaaaaaatttggattcggtccttgtaaaaaaattttgtttt |
28819636 |
T |
 |
| Q |
223 |
agaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| || |||||| | ||||||| |||| ||||||||||| | |||||||||| |
|
|
| T |
28819637 |
ggaaaa-cccccctagaccagctgactgtgcatttttgctgttggggcatgctacgtcaccctttttggatgacgtggcacgctgactgtat |
28819727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 120 - 314
Target Start/End: Complemental strand, 11890158 - 11889966
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnntttattcggtccttgtnnnnnnnttttgt |
219 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| | ||||||||||||| |||||| |
|
|
| T |
11890158 |
tttgggttaataggcctttacccc-tgtaatataggtcacttttggttttgccccctgtaataaaaaattctggattcggtccttgtaaattttttttgt |
11890060 |
T |
 |
| Q |
220 |
tttagaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||| ||||| ||| | ||||||||||||||||||||||||||||||||||| ||||||| ||| ||||| ||||||| |||| ||||| |
|
|
| T |
11890059 |
tttggaaaa-ccctcataggcaagctgactgtgcatttttgctgatgtggcatgttgtgtcacctattttggatgatgtggcgcgctgattgtat |
11889966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 15061880 - 15061825
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
15061880 |
gggttaataggtctttaccccctgtaatatagggcacttttggttttgccccctgt |
15061825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 11466006 - 11466080
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||| || ||||| |||||||||||||| || |||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11466006 |
ccagctgactatgtattttcgctgatgtggcatgctgagtcacctttttctgatgacgtggcgcgctgactgtat |
11466080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 19600086 - 19600164
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||| ||||||||||||||||| |||||||||||||| ||||| |||| ||||||||||||| |||||||||| |
|
|
| T |
19600086 |
tagaccagccgactgtgcatttttgctaatgtggcatgttgcttcaccctttttggatgacgtggcgcgctgactgtat |
19600164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 35600482 - 35600404
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||| | |||||||||||| |||||||||||| |||||||||| |
|
|
| T |
35600482 |
tagaccagctaactgtgcatttttgctgatgtggcatgctccgtcaccttttttggatgacgtggcgggctgactgtat |
35600404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 21776967 - 21776908
Alignment:
| Q |
120 |
tttgggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
21776967 |
tttgggttaataggtctttacccctctgtaatatagggcacttttggttttgccccctgt |
21776908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 112 - 174
Target Start/End: Original strand, 30796568 - 30796630
Alignment:
| Q |
112 |
aataattgtttgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
30796568 |
aataattaattgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
30796630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 11957706 - 11957650
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
11957706 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
11957650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 15060163 - 15060219
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
15060163 |
gggttaataggtctttacccccctgtaatataggacacttttggttttgccccctgt |
15060219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 175
Target Start/End: Original strand, 15615103 - 15615155
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccc |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
15615103 |
gggttaataggtctttaccccctgtaatatagggcacttttggttttgtcccc |
15615155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 15616557 - 15616501
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
15616557 |
gggttaataggtctttacccccctgtaatataggacacttttggttttgccccctgt |
15616501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 41064144 - 41064200
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
41064144 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
41064200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 252 - 314
Target Start/End: Original strand, 11889382 - 11889444
Alignment:
| Q |
252 |
gcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||||| ||||||||||||| |||||||||| |
|
|
| T |
11889382 |
gcatttttgctgatgtcgcatgttgcgtcatcttttttggatgacgtggcgcgctgactgtat |
11889444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 13948638 - 13948584
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| ||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
13948638 |
ggttaataggcctttacctcctgtaatatagggcacttttggttttgccccctgt |
13948584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 19599970 - 19600024
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19599970 |
gggttaataggcctttacccccctgtaatataggtcacttttggttttgccccct |
19600024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 121 - 178
Target Start/End: Complemental strand, 12399645 - 12399588
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||| |||||| |||||||| |
|
|
| T |
12399645 |
ttgggttaataggtctttaccccctgtaatataggttattttcggttttcccccctgt |
12399588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 49 - 110
Target Start/End: Complemental strand, 34905632 - 34905571
Alignment:
| Q |
49 |
tgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctattaac |
110 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||||||| |||||||||||| |||||||| |
|
|
| T |
34905632 |
tgagcgacctcattggtttgtctcctattgaactcaacacaagagttctgaaaactattaac |
34905571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 9750447 - 9750503
Alignment:
| Q |
123 |
gggttaataggtctttaccccct-gtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
9750447 |
gggttaataggcctttacccccttgtaatataggtcacttttggttttgtcccctgt |
9750503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 10011619 - 10011671
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
10011619 |
ggttaataggtctttatcccgtgtaatataggacacttttggttttgccccct |
10011671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 11956139 - 11956195
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||| ||||||| |
|
|
| T |
11956139 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttggcccctgt |
11956195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 243 - 314
Target Start/End: Original strand, 15395662 - 15395734
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacc-tttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||| || |||||| ||||| |||||| |||||| |||||||||| |
|
|
| T |
15395662 |
gctgactgtgcatttttgctgatgtggcatgctgtgtcaccttttttatgatgaagtggcgtgctgactgtat |
15395734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 41065714 - 41065658
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||| ||||||| |
|
|
| T |
41065714 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttggcccctgt |
41065658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 26034845 - 26034900
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||||| |||||||||| |||||||| |
|
|
| T |
26034845 |
gggttaataggtctttaccctctgcaatataggtcatttttggtttttccccctgt |
26034900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 251 - 314
Target Start/End: Original strand, 29320240 - 29320303
Alignment:
| Q |
251 |
tgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||| |||||| || |||| ||||||||||||| |||||||||| |
|
|
| T |
29320240 |
tgcatttttgctgatgtggcatgctgcgtcgccctttttggatgacgtggcgcgctgactgtat |
29320303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 35600595 - 35600540
Alignment:
| Q |
124 |
ggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| |||||||||| |||||||||||||||||||||||||||||| ||| |
|
|
| T |
35600595 |
ggttaataggcctttacccccctgtaatataggtcacttttggttttgccccttgt |
35600540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 38482318 - 38482373
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||| | |||||| |
|
|
| T |
38482318 |
gggttaataggtctttaccccctgtaatataggtcaattctggttttcctccctgt |
38482373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 5700608 - 5700530
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||| ||||||| ||| |||||||| || |||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
5700608 |
tagaccagctgactgcgcattttcgcttatgtggcacactgagtcaccattttctgatgacgtggcacgctgactgtat |
5700530 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 29321248 - 29321170
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||| |||||||| ||| |||||||||||| |||||||||| |
|
|
| T |
29321248 |
tagaccagctgaatgtgcatttatgctgatgtggcatgctgcgtcacacattttaaatgacgtggcgcgctgactgtat |
29321170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 241 - 314
Target Start/End: Complemental strand, 11466640 - 11466567
Alignment:
| Q |
241 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||| || |||||| ||||||||| ||||||||| ||||| |||| |
|
|
| T |
11466640 |
cagctgactgtgcattttcgctgatgtggcacactgagtcaccgttttctgatcacgtggcgcgctgacagtat |
11466567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 123 - 168
Target Start/End: Original strand, 15395544 - 15395589
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttt |
168 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
15395544 |
gggttaataggtttttaccccctgtaaaataggtcacttttggttt |
15395589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 123 - 171
Target Start/End: Complemental strand, 19601324 - 19601275
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgc |
171 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
19601324 |
gggttaataggcctttacccccctgtaatataggtcacttttggttttgc |
19601275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 125 - 174
Target Start/End: Complemental strand, 23932510 - 23932461
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||| |||| |
|
|
| T |
23932510 |
gttaataggtctttatcccctgcaatataggtcacttttggtttttcccc |
23932461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 120 - 176
Target Start/End: Complemental strand, 10012866 - 10012810
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||| ||||||||||||| ||||| |
|
|
| T |
10012866 |
tttgggttaataggtctttatcctctgtaatatagggtacttttggttttgtcccct |
10012810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 163
Target Start/End: Original strand, 22551522 - 22551562
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcactttt |
163 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
22551522 |
gggttaataggtctttaccccctgtaatataggtcattttt |
22551562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 36993041 - 36992985
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| || |||||| |||||||| |
|
|
| T |
36993041 |
tgggttaataggtctttaccctctgtaatataggtcatttccggtttttccccctgt |
36992985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 889068 - 889123
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||| ||||||||| || ||||| |
|
|
| T |
889068 |
gggttaataggtctttaccccttgtaatataggccacatttggttttccctcctgt |
889123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 9227141 - 9227086
Alignment:
| Q |
124 |
ggttaataggtctttac-cccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| || ||||||| |||||||| |
|
|
| T |
9227141 |
ggttaataggtctttacacccctgtaatataggtcatttctggttttcccccctgt |
9227086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 10976804 - 10976769
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
10976804 |
gggttaataggtctttaccccctgtaatataggtca |
10976769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 11438339 - 11438394
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
11438339 |
gggttaatagagctttaccccctgtaatatagggtacttttggttttgctccctgt |
11438394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 11439854 - 11439803
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||| | |||||||||||| |||||||||||||||||| |
|
|
| T |
11439854 |
gggttaataggtctttatctcctgtaatatagagcacttttggttttgcccc |
11439803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 122 - 169
Target Start/End: Original strand, 12330853 - 12330900
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
12330853 |
tgggttaatatgtctttaacccctgtaatataggtcatttttggtttt |
12330900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 24098720 - 24098665
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| |||||||||| || ||||| |
|
|
| T |
24098720 |
gggttaataggtctttagcccttgtaatataggtcatttttggttttccctcctgt |
24098665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 26888514 - 26888459
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| ||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
26888514 |
gggttaatagtgttttaccctctataatataggtcacttttggttttgccccctgt |
26888459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 29104444 - 29104479
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
29104444 |
gggttaataggtctttaccccctgtaatataggtca |
29104479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 30798635 - 30798580
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||| ||| ||||||||||||| |
|
|
| T |
30798635 |
gggttaataggtctttaccccccttaatatagggcactattgattttgccccctgt |
30798580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 122 - 169
Target Start/End: Complemental strand, 34407951 - 34407904
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||| |||| |||||||||||||||||| ||||||||||||||| |
|
|
| T |
34407951 |
tgggttaaaaggtatttaccccctgtaatataagtcacttttggtttt |
34407904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 37274748 - 37274803
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
37274748 |
gggttaatagagctttaccccctataatatagggtacttttggttttgccccctgt |
37274803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 120 - 158
Target Start/End: Complemental strand, 2870944 - 2870906
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2870944 |
tttgggttaataggtctttacctcctgtaatataggtca |
2870906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 4602286 - 4602359
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||| |||| |||||| || ||||||||| |||||||||| |
|
|
| T |
4602286 |
ccagttgactgtgcatttttgctgatgtgacatgttgtgtca-cttttttgaatcacgtggcgcgctgactgtat |
4602359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 5802416 - 5802470
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||| || ||||||| |||||||| |
|
|
| T |
5802416 |
ggttaatagatctttaccccctgcaatataggtcatttctggtttttccccctgt |
5802470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 136 - 178
Target Start/End: Complemental strand, 25453917 - 25453875
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||||||||||| |
|
|
| T |
25453917 |
tttaccctctgtaatatatgtcacttttggttttgccccctgt |
25453875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 140 - 178
Target Start/End: Complemental strand, 28820595 - 28820557
Alignment:
| Q |
140 |
ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
28820595 |
ccccctgtaatataggtcacttttgattttgccccctgt |
28820557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 178
Target Start/End: Complemental strand, 5700718 - 5700665
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||| |||| |||||||| |
|
|
| T |
5700718 |
gttaatagacctttaccccctgcaatataggtcacttttgattttcccccctgt |
5700665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 124 - 169
Target Start/End: Complemental strand, 21149156 - 21149112
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
21149156 |
ggttaataggtctttacccc-tgtaatataggtcatttttggtttt |
21149112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 711237 - 711289
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| || ||||||| |||| |
|
|
| T |
711237 |
gggttaataggtctttacccccctgtaatataggtcatttatggttttccccc |
711289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 171
Target Start/End: Complemental strand, 8368054 - 8368006
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgc |
171 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||| ||||||||||||||| |
|
|
| T |
8368054 |
gggttaataggtctttaccctctgtagtatagagcacttttggttttgc |
8368006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 126 - 158
Target Start/End: Complemental strand, 20689082 - 20689050
Alignment:
| Q |
126 |
ttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
20689082 |
ttaataggtctttaccccctgtaatataggtca |
20689050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 25088928 - 25088868
Alignment:
| Q |
118 |
tgtttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||| |||||| | |||||| |
|
|
| T |
25088928 |
tgtttgggttaatagtgttttaccccttgtaatataggtcactttcggttttccaccctgt |
25088868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 118 - 178
Target Start/End: Complemental strand, 25146897 - 25146837
Alignment:
| Q |
118 |
tgtttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||||||||| |||||| | |||||| |
|
|
| T |
25146897 |
tgtttgggttaatagtgttttaccccttgtaatataggtcactttcggttttccaccctgt |
25146837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 29321365 - 29321309
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||| || | |||||||||||||| ||||||||||| ||||||| |
|
|
| T |
29321365 |
gggttaataggtctttatcctcatgtaatataggtcatttttggttttgtcccctgt |
29321309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 163
Target Start/End: Original strand, 33052817 - 33052857
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcactttt |
163 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
33052817 |
gggttaataggtctttaccccttgtaatataggtcattttt |
33052857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 101
Target Start/End: Original strand, 41197410 - 41197462
Alignment:
| Q |
49 |
tgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaa |
101 |
Q |
| |
|
||||||||| |||| | |||||||||||||||||| |||| |||||||||||| |
|
|
| T |
41197410 |
tgagcgaccccattggcttgcctcctattgaactcgacataagagttctgaaa |
41197462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 240 - 271
Target Start/End: Original strand, 5699871 - 5699902
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggca |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5699871 |
ccagctgactgtgcatttttgctgatgtggca |
5699902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 6055237 - 6055178
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||| ||||||||||||| || ||||| |
|
|
| T |
6055237 |
tttgggttaataggattttacccccctgtaatataggacacttttggttttccctcctgt |
6055178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 178
Target Start/End: Original strand, 10598331 - 10598374
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| |||||||| |
|
|
| T |
10598331 |
ctttaccccctgtaatataggtcattttttgttttcccccctgt |
10598374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 18229749 - 18229796
Alignment:
| Q |
123 |
gggttaataggtctttac-cccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||| |||||| |
|
|
| T |
18229749 |
gggttaataggtctttacacccctgtaatataggtcattttcggtttt |
18229796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 20698577 - 20698526
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| || ||||||| |||| |
|
|
| T |
20698577 |
gggttaataggtctttacttcctgtaatataggtcatttctggtttttcccc |
20698526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 9 - 112
Target Start/End: Complemental strand, 24275339 - 24275236
Alignment:
| Q |
9 |
atggggactatgattagatagggttgtctaaactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctatta |
108 |
Q |
| |
|
|||||| ||| |||||||||||| || || | |||| | |||||| |||| ||| | |||||| | | ||||||||||||||| |||||||||| ||| | |
|
|
| T |
24275339 |
atgggggctaggattagatagggatgcctgagctaactcgtgagctaccttatttgcttgccttcgactgaactcaacatgagtgttctgaaatttatca |
24275240 |
T |
 |
| Q |
109 |
acta |
112 |
Q |
| |
|
|||| |
|
|
| T |
24275239 |
acta |
24275236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 9 - 112
Target Start/End: Original strand, 24386874 - 24386977
Alignment:
| Q |
9 |
atggggactatgattagatagggttgtctaaactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctatta |
108 |
Q |
| |
|
|||||| ||| |||||||||||| || || | |||| | |||||| |||| ||| | |||||| | | ||||||||||||||| |||||||||| ||| | |
|
|
| T |
24386874 |
atgggggctaggattagatagggatgcctgagctaactcgtgagctaccttatttgcttgccttcgactgaactcaacatgagtgttctgaaatttatca |
24386973 |
T |
 |
| Q |
109 |
acta |
112 |
Q |
| |
|
|||| |
|
|
| T |
24386974 |
acta |
24386977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 25962802 - 25962857
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
25962802 |
gggttaatagtgttttaccccctgtaatataggtcattttcggttttaccccctgt |
25962857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 178
Target Start/End: Original strand, 28519499 - 28519542
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| |||||||| |
|
|
| T |
28519499 |
ctttaccccctgtaatataggtcattttttgtttttccccctgt |
28519542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 9 - 112
Target Start/End: Complemental strand, 30304918 - 30304815
Alignment:
| Q |
9 |
atggggactatgattagatagggttgtctaaactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctatta |
108 |
Q |
| |
|
|||||| ||| |||||||||||| || || | |||| | |||||| ||| ||| | |||||||| ||||||||||||||||||||||||| |||| | |
|
|
| T |
30304918 |
atgggggctaggattagatagggctgcctgagctaactcgtgagctaccctatttgcttgcctccggctgaactcaacatgagagttctgaaaactatca |
30304819 |
T |
 |
| Q |
109 |
acta |
112 |
Q |
| |
|
|||| |
|
|
| T |
30304818 |
acta |
30304815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 31861491 - 31861526
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
31861491 |
gggttaataggtctttatcccctgtaatataggtca |
31861526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 33658871 - 33658926
Alignment:
| Q |
124 |
ggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| || |||||| |||||||| |
|
|
| T |
33658871 |
ggttaataggtctttacccccctgtaatataggtcatttccggttttcccccctgt |
33658926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 120 - 158
Target Start/End: Complemental strand, 39419012 - 39418973
Alignment:
| Q |
120 |
tttgggttaataggtctttac-cccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
39419012 |
tttgggttaataggtctttacccccctgtaatataggtca |
39418973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 136 - 178
Target Start/End: Original strand, 1497342 - 1497384
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||| |||||||| |
|
|
| T |
1497342 |
tttaccccctgtaatataggtcattttttgttttcccccctgt |
1497384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 136 - 178
Target Start/End: Complemental strand, 3214887 - 3214845
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |||||||| |
|
|
| T |
3214887 |
tttaccccctgtaatataggtcacttccggtttttccccctgt |
3214845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 9672894 - 9672948
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||| |||| ||||| |||| |
|
|
| T |
9672894 |
tttgggttaatggtgctttaccccctgtaatataggtcattttttgttttccccc |
9672948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 140 - 178
Target Start/End: Complemental strand, 9673169 - 9673131
Alignment:
| Q |
140 |
ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
9673169 |
ccccctgtaatataggtcatttttggttttcccccctgt |
9673131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 120 - 154
Target Start/End: Complemental strand, 11664312 - 11664278
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatatag |
154 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
11664312 |
tttgggttaataggtctttaccccttgtaatatag |
11664278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 107
Target Start/End: Original strand, 12714893 - 12714959
Alignment:
| Q |
41 |
ctaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctatt |
107 |
Q |
| |
|
||||||| ||| ||||| |||| | |||| |||| |||||| ||||||||||||||||||| ||||| |
|
|
| T |
12714893 |
ctaatttatgaacgaccccattaggttgcttccttttgaacccaacatgagagttctgaaaactatt |
12714959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 41 - 107
Target Start/End: Original strand, 12776124 - 12776190
Alignment:
| Q |
41 |
ctaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctatt |
107 |
Q |
| |
|
||||||| ||| ||||| |||| | |||| |||| |||||| ||||||||||||||||||| ||||| |
|
|
| T |
12776124 |
ctaatttatgaacgaccccattaggttgcttccttttgaacccaacatgagagttctgaaaactatt |
12776190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 241 - 303
Target Start/End: Original strand, 14310255 - 14310316
Alignment:
| Q |
241 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgc |
303 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
14310255 |
cagctgactgtgca-ttttgctgatgtggcatgcaaagtcacctttttcgaatgacgtggcgc |
14310316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 136 - 178
Target Start/End: Complemental strand, 18254412 - 18254370
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||| |||||||| |
|
|
| T |
18254412 |
tttaccccctgtaatataggtcattttttgttttcccccctgt |
18254370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 111 - 169
Target Start/End: Original strand, 20076653 - 20076711
Alignment:
| Q |
111 |
taataattgtttgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||| ||||||| || ||||||||||| ||||||||||||||| ||| |||||| |
|
|
| T |
20076653 |
taataattttttgggtcaacaggtctttaccttctgtaatataggtcattttcggtttt |
20076711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 64 - 106
Target Start/End: Complemental strand, 24870472 - 24870430
Alignment:
| Q |
64 |
gtttgcctcctattgaactcaacatgagagttctgaaatctat |
106 |
Q |
| |
|
|||||||| || ||||||||||| ||||||||||||||||||| |
|
|
| T |
24870472 |
gtttgccttctgttgaactcaacttgagagttctgaaatctat |
24870430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 35798740 - 35798694
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||| ||| |||||| |
|
|
| T |
35798740 |
gggttagtaggtctttatcccctgtaatataggtcattttcggtttt |
35798694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 37205037 - 37204991
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||||| ||| |||||| |
|
|
| T |
37205037 |
gggttaatatgtctttaccctctgtaatataggtcattttcggtttt |
37204991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 120 - 158
Target Start/End: Complemental strand, 40657962 - 40657924
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
40657962 |
tttggattaatagggctttaccccctgtaatataggtca |
40657924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 123 - 175
Target Start/End: Complemental strand, 711516 - 711463
Alignment:
| Q |
123 |
gggttaataggtctttac-cccctgtaatataggtcacttttggttttgccccc |
175 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||| ||||| ||||| |
|
|
| T |
711516 |
gggttaataggtctttacccccctgtaatataggtcattttcagtttttccccc |
711463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 136 - 169
Target Start/End: Complemental strand, 4222010 - 4221977
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
4222010 |
tttaccccctgtaatataggtcatttttggtttt |
4221977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 120 - 149
Target Start/End: Complemental strand, 5718462 - 5718433
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaa |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
5718462 |
tttgggttaataggtctttaccccctgtaa |
5718433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 12823773 - 12823724
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||| |||||| |||| ||||||||||| |||| ||||| |
|
|
| T |
12823773 |
tttgggttaataggtttttacctcctgcaatataggtcattttttgtttt |
12823724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 127 - 172
Target Start/End: Complemental strand, 14311794 - 14311749
Alignment:
| Q |
127 |
taataggtctttaccccctgtaatataggtcacttttggttttgcc |
172 |
Q |
| |
|
||||||| |||||||| ||||||||||||||| ||||| ||||||| |
|
|
| T |
14311794 |
taataggcctttacccactgtaatataggtcatttttgattttgcc |
14311749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 158
Target Start/End: Complemental strand, 16305164 - 16305131
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
16305164 |
gttaataggtctttaccctctgtaatataggtca |
16305131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 128 - 169
Target Start/End: Original strand, 20688801 - 20688842
Alignment:
| Q |
128 |
aataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||| |||||| |
|
|
| T |
20688801 |
aataggtctttacctcctgtaatataggtcattttcggtttt |
20688842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 136 - 176
Target Start/End: Complemental strand, 7899969 - 7899929
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||| |||||| |
|
|
| T |
7899969 |
tttaccccctgtaatataggtcattttttgttttcccccct |
7899929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 60 - 112
Target Start/End: Original strand, 8703559 - 8703611
Alignment:
| Q |
60 |
attcgtttgcctcctattgaactcaacatgagagttctgaaatctattaacta |
112 |
Q |
| |
|
||||| ||||||| | |||||| |||||||||||||| |||||||||| |||| |
|
|
| T |
8703559 |
attcgcttgcctcgtgttgaacacaacatgagagttccgaaatctattcacta |
8703611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 55 - 95
Target Start/End: Original strand, 11619189 - 11619229
Alignment:
| Q |
55 |
acctcattcgtttgcctcctattgaactcaacatgagagtt |
95 |
Q |
| |
|
||||||||||||||||||||| | ||||| ||||||||||| |
|
|
| T |
11619189 |
acctcattcgtttgcctcctaataaactcgacatgagagtt |
11619229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 13012434 - 13012490
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||| |||| ||||| || ||||| |
|
|
| T |
13012434 |
tgggttaatggtgctttaccccctgtaatataggtcattttttgttttccctcctgt |
13012490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 13083844 - 13083900
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||| | |||||||||||||||||||||||| |||| ||||| || ||||| |
|
|
| T |
13083844 |
tgggttaatggtgctttaccccctgtaatataggtcattttttgttttccctcctgt |
13083900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 126 - 158
Target Start/End: Original strand, 22642127 - 22642159
Alignment:
| Q |
126 |
ttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
22642127 |
ttaataggtcttcaccccctgtaatataggtca |
22642159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 22642380 - 22642344
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
22642380 |
gggttaataggtctttacccctctgtaatataggtca |
22642344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 125 - 157
Target Start/End: Complemental strand, 24329572 - 24329540
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtc |
157 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
24329572 |
gttaataggtctttaccccttgtaatataggtc |
24329540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 145 - 177
Target Start/End: Original strand, 29320139 - 29320171
Alignment:
| Q |
145 |
tgtaatataggtcacttttggttttgccccctg |
177 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| |
|
|
| T |
29320139 |
tgtaatataggtcacttttggttttgcgccctg |
29320171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 121 - 169
Target Start/End: Complemental strand, 36518918 - 36518870
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||| |||| ||||| |
|
|
| T |
36518918 |
ttgggttaatggtgctttaccccctgtaatataggtcattttttgtttt |
36518870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 47 - 95
Target Start/End: Original strand, 36961984 - 36962032
Alignment:
| Q |
47 |
tgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagtt |
95 |
Q |
| |
|
||||||| |||||||| | |||||||||| | ||||||||||||||||| |
|
|
| T |
36961984 |
tgtgagcaacctcatttgcttgcctcctaataaactcaacatgagagtt |
36962032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 122 - 154
Target Start/End: Original strand, 38313169 - 38313201
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatatag |
154 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |
|
|
| T |
38313169 |
tgggttaataggtctttatcccctgtaatatag |
38313201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 39153416 - 39153452
Alignment:
| Q |
123 |
gggttaataggtcttta-ccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39153416 |
gggttaataggtctttacccccctgtaatataggtca |
39153452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 47 - 95
Target Start/End: Complemental strand, 42765336 - 42765288
Alignment:
| Q |
47 |
tgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagtt |
95 |
Q |
| |
|
||||||| |||||||| | |||||||||| | ||||||||||||||||| |
|
|
| T |
42765336 |
tgtgagcaacctcatttgcttgcctcctaataaactcaacatgagagtt |
42765288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 71; Significance: 4e-32; HSPs: 151)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 122 - 314
Target Start/End: Original strand, 550672 - 550864
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnnttt-attcggtccttgtnnnnnnnttttgtt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||||||||| ||| || ||||||||||||| ||||||| |
|
|
| T |
550672 |
tgggttaataggtctttaccccctgtaatataggtcatttttagttttgccccttgtaaaattttttttttggattcggtccttgtaaaatttttttgtt |
550771 |
T |
 |
| Q |
221 |
ttagaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|| ||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
550772 |
ttggaaaacccccc-tagaccagctgactgtgcatttttgctgatgtggcatgctgcgtcacctttttcagatgacgtggcgcgctgactgtat |
550864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 122 - 314
Target Start/End: Complemental strand, 34027252 - 34027061
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnntt-tattcggtccttgtnnnnnnnttttgtt |
220 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| ||||||| |
|
|
| T |
34027252 |
tgggttaataggcctttaccccctgtaatataggtcacttttggttttgccccctgtaaaaaaaaacttttcgattcggtccttgtaaaatttttttgtt |
34027153 |
T |
 |
| Q |
221 |
ttagaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|| ||||| ||||||||||||||||||||||||||||||||||||||||| |||| | |||| ||||| ||||||| |||||||||| |
|
|
| T |
34027152 |
ttggaaaa--ccccctagaccagctgactgtgcatttttgctgatgtggcatgttgtgtcagcctttttggatgatgtggcgcgctgactgtat |
34027061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 236 - 312
Target Start/End: Original strand, 51162188 - 51162264
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgt |
312 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51162188 |
tagaccaactgactgtgcatttttgttgatgtggcatgttgcgtcaccttttttggatgacgtggcgcactgactgt |
51162264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 34026027 - 34026105
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||| |||||||||||||||||||| |||||| |||||| |||||||||| |
|
|
| T |
34026027 |
tagaccagttgactgtgtatttttgctgatgtgacatgttgcgtcacctttttcggatgacatggcgcgctgactgtat |
34026105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 242 - 314
Target Start/End: Original strand, 48029529 - 48029601
Alignment:
| Q |
242 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
48029529 |
agctgactgtgcatttttgctgatgaggcatgttgtgtcaccttttttggatgacgtggcgcgctgactgtat |
48029601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 50881479 - 50881424
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50881479 |
gggttaataggtctttaccccctgtaatataggccacttttggttttgccccctgt |
50881424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 54554383 - 54554438
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
54554383 |
gggttaataggtctttaccccctgtaatatagggcacttttggttttgccccctgt |
54554438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 47765369 - 47765443
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | || |||||| |||||||||||||| ||||||||||||||| |
|
|
| T |
47765369 |
ccagctgactgtgcattttcgctgatgtggcacgctgagtcaccattttctgatgacgtcgcgcactgactgtat |
47765443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 7 - 116
Target Start/End: Complemental strand, 9633157 - 9633048
Alignment:
| Q |
7 |
atatggggactatgattagatagggttgtctaaactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctat |
106 |
Q |
| |
|
|||||||| ||| ||| |||||| |||||| | |||| | || | ||||| ||||| |||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9633157 |
atatgggggctagtattggataggattgtctgagctaactcgtaatcgaccccattcacttgcctcctattgaactcgacatgagagttctgaaatctat |
9633058 |
T |
 |
| Q |
107 |
taactaataa |
116 |
Q |
| |
|
|||||||||| |
|
|
| T |
9633057 |
taactaataa |
9633048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 59 - 122
Target Start/End: Original strand, 17283585 - 17283648
Alignment:
| Q |
59 |
cattcgtttgcctcctattgaactcaacatgagagttctgaaatctattaactaataattgttt |
122 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||||||||||||||| ||||||| |||||| |
|
|
| T |
17283585 |
cattcgtttgcctcctattgaactcgacataagagttctgaaatctattgactaatagttgttt |
17283648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 236 - 299
Target Start/End: Complemental strand, 43860856 - 43860793
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtg |
299 |
Q |
| |
|
||||||| ||||||||||||||| |||||||||||||| || |||||||||||||||||||||| |
|
|
| T |
43860856 |
tagaccacctgactgtgcattttcgctgatgtggcatgctgagtcacctttttctgatgacgtg |
43860793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 239 - 314
Target Start/End: Complemental strand, 44071242 - 44071167
Alignment:
| Q |
239 |
accagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||| |||||||||||||||| ||||||||||||| |||||||||||||| ||||| ||||||| |||||||||| |
|
|
| T |
44071242 |
accaactgactgtgcatttttactgatgtggcatgctgcgtcacctttttaggatgatgtggcgcgctgactgtat |
44071167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 13127601 - 13127679
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||| |||||||||| || ||||||||||||| ||||||||||||||||||||| ||||| | |||||||||| |
|
|
| T |
13127601 |
tagaccagcagactgtgcatgttcgctgatgtggcatcatgcgtcacctttttctgatgatgtggcacgctgactgtat |
13127679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 244 - 302
Target Start/End: Original strand, 39865130 - 39865188
Alignment:
| Q |
244 |
ctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcg |
302 |
Q |
| |
|
||||||||||||||||| |||||||||||| || ||||||||||||||||||||||||| |
|
|
| T |
39865130 |
ctgactgtgcatttttggtgatgtggcatgatgtgtcacctttttctgatgacgtggcg |
39865188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 51164080 - 51164022
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||| ||||||||| ||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51164080 |
tttgcgttaataggcctttaccccctataatataggtcacttttggttttgccccctgt |
51164022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 54053686 - 54053760
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||| ||||||||||| ||||| ||||||| |||| ||||| |
|
|
| T |
54053686 |
ccagctgactgtgtatttttgctgatgtggcatgatgcatcacctttttcggatgaggtggcgcgctgattgtat |
54053760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 121 - 178
Target Start/End: Complemental strand, 54555410 - 54555353
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
54555410 |
ttgggttaataagtctttaccccctgtaatatatggcacttttggttttgccccctgt |
54555353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 12566996 - 12566940
Alignment:
| Q |
123 |
gggttaataggtctttaccccct-gtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
12566996 |
gggttaataggtctttacccccttgtaatatagggcacttttggttttgccccctgt |
12566940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 241 - 301
Target Start/End: Complemental strand, 12760688 - 12760629
Alignment:
| Q |
241 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggc |
301 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
12760688 |
cagctgactgtgcattttcgctgatgtggcatgttgcgtaacc-ttttctgatgacgtggc |
12760629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 237 - 301
Target Start/End: Original strand, 13741532 - 13741596
Alignment:
| Q |
237 |
agaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggc |
301 |
Q |
| |
|
||||||||| |||||||||||| |||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
13741532 |
agaccagctaactgtgcattttctctgacatggcatgttgcgtcacctttttctgatgacgtggc |
13741596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 242 - 314
Target Start/End: Complemental strand, 20613832 - 20613760
Alignment:
| Q |
242 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||| ||||| |||||||||||||| || |||||| ||||||||||||||||||| |||| ||||| |
|
|
| T |
20613832 |
agctgactgtgtattttcgctgatgtggcatgatgagtcaccattttctgatgacgtggcgcgctgaatgtat |
20613760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 243 - 314
Target Start/End: Complemental strand, 145134 - 145063
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||| | ||||||||||||||||||||| | ||||||||||| |||||| ||||||| |||||||||| |
|
|
| T |
145134 |
gctgactgcgaatttttgctgatgtggcatgtcgtgtcacctttttatgatgatgtggcgcgctgactgtat |
145063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 20962194 - 20962249
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| |||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
20962194 |
gggttaatagatctttaccccctgtaatatatggcacttttggttttgccccctgt |
20962249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 29248242 - 29248297
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||| ||| |||| |
|
|
| T |
29248242 |
gggttaataggtctttaccccctgtaatataggacacttttggttttacccgctgt |
29248297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 243 - 314
Target Start/End: Complemental strand, 39865917 - 39865847
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||| |||| || ||||||||||| |||||||||||||| | |||||||| |
|
|
| T |
39865917 |
gctgactgtgcatttttgctgatgtgacatgatgtgtcaccttttt-tgatgacgtggcgcgccgactgtat |
39865847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 50138488 - 50138543
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
50138488 |
gggttaataggtctttaccccctgtaatataggtcattttcggtttttccccctgt |
50138543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 240 - 314
Target Start/End: Complemental strand, 3673299 - 3673225
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||| |||||||| ||||| | |||| | ||||||||||||||||||| |||||||||| |
|
|
| T |
3673299 |
ccagctgactgtgcattttcgctgatgtagcatgctaggtcatcgttttctgatgacgtggcgcgctgactgtat |
3673225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 7515733 - 7515655
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||| |||| | ||||||||||||||||||||||||| ||||||||| |||| ||||||||||| | |||||||||| |
|
|
| T |
7515733 |
tagactagctaattgtgcatttttgctgatgtggcatgctgcgtcaccctttttggatgacgtggcacgctgactgtat |
7515655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 244 - 314
Target Start/End: Complemental strand, 12352395 - 12352325
Alignment:
| Q |
244 |
ctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||| ||||| |||||||||||||| |||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
12352395 |
ctgactgtgaattttcgctgatgtggcatgctgcgtcacctttttctgatgacatggcatgctgactgtat |
12352325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 121 - 178
Target Start/End: Complemental strand, 20963759 - 20963701
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||| |||||||||||| |
|
|
| T |
20963759 |
ttgggttaataggtctttacccccctgtaatatagggcacttttggctttgccccctgt |
20963701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 21994328 - 21994382
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| ||||| ||||||| |
|
|
| T |
21994328 |
ggttaataggtctttaccccctgtaatataggacacttttgattttgtcccctgt |
21994382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 20 - 106
Target Start/End: Complemental strand, 35096994 - 35096908
Alignment:
| Q |
20 |
gattagatagggttgtctaaactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctat |
106 |
Q |
| |
|
|||||||||||||||||| | |||| | |||||| ||| ||| | |||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
35096994 |
gattagatagggttgtctgagctaactcgtgagcaaccctatttgcttgccttctattgaactcgacatgagagttctgaaatctat |
35096908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 44070195 - 44070273
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||| |||||||||||| |||||| ||| || |||||||||| |
|
|
| T |
44070195 |
tagaccagctgactgtgcatttttgctgatgtgacatgcaacgtcaccttttttggatgacatggtgcgctgactgtat |
44070273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 126 - 178
Target Start/End: Complemental strand, 34741448 - 34741395
Alignment:
| Q |
126 |
ttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
34741448 |
ttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
34741395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 125 - 169
Target Start/End: Complemental strand, 12352514 - 12352470
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
12352514 |
gttaataggcctttaccccctgtaatataggtcacttttggtttt |
12352470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 126 - 178
Target Start/End: Original strand, 20612969 - 20613021
Alignment:
| Q |
126 |
ttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
20612969 |
ttaataggcctttaccccctgcaatataggtcacttttggttttcccccctgt |
20613021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 122 - 174
Target Start/End: Complemental strand, 24701259 - 24701207
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
24701259 |
tgggttaataggcctttaccccctgcaatataggtcacttttggttttccccc |
24701207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 29249767 - 29249711
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
29249767 |
gggttaataggtctttacccccctgtaatatagggaacttttggttttgccccctgt |
29249711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 34739888 - 34739944
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||| ||||||| |
|
|
| T |
34739888 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttggcccctgt |
34739944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 118 - 178
Target Start/End: Original strand, 41331764 - 41331824
Alignment:
| Q |
118 |
tgtttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||| ||||||||||||||||| |||||| |||||||||||||||||||||| || ||||| |
|
|
| T |
41331764 |
tgttagggttaataggtctttatcccctgcaatataggtcacttttggtttttcctcctgt |
41331824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 236 - 300
Target Start/End: Original strand, 41331883 - 41331947
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtgg |
300 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||| | || ||||||||||| ||||||||||| |
|
|
| T |
41331883 |
tagatcagctgactgtgcattttcgctgatgtggcacgctgagtcacctttttttgatgacgtgg |
41331947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 126 - 178
Target Start/End: Original strand, 51752686 - 51752738
Alignment:
| Q |
126 |
ttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||| | |||||||| ||||||||||||| |
|
|
| T |
51752686 |
ttaataggtctttaccccctgtaatatatgacacttttgattttgccccctgt |
51752738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 55500463 - 55500407
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| || ||||||||||||||||||| |
|
|
| T |
55500463 |
gggttaataggtctttacccccctgtaatataggacatttttggttttgccccctgt |
55500407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 11563574 - 11563519
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||| ||||||| |
|
|
| T |
11563574 |
gggttaataggtctttaccccctgtaatataggtcatttctggttttttcccctgt |
11563519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 239 - 314
Target Start/End: Original strand, 12351580 - 12351655
Alignment:
| Q |
239 |
accagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||| |||| ||| ||||||||| ||||||||| |||||||||||| |||||||||| |
|
|
| T |
12351580 |
accagctgactgtgcattttcactgacgtgacatgttgcgccacctttttatgatgacgtggcatgctgactgtat |
12351655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 21780122 - 21780173
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||| |||| |
|
|
| T |
21780122 |
gggttaataggtctttaccccctgtaatataggtcattttcggttttccccc |
21780173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 24215798 - 24215743
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || ||||||| ||||||| |
|
|
| T |
24215798 |
gggttaataggtctttaccccctgtaatataggtcatttctggttttctcccctgt |
24215743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 170
Target Start/End: Complemental strand, 43860970 - 43860923
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttg |
170 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
43860970 |
gggttaataggtctttacctcctgtaatatagggcacttttggttttg |
43860923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 48029415 - 48029469
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
48029415 |
gggttaataggcctttaccccctgtaatttaggtca-ttttggttttgccccctgt |
48029469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 54354251 - 54354192
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||| |||||||||| || |||||||||||||||||||||| |||||||| |
|
|
| T |
54354251 |
tttgggttaataggcctttacccccctgcaatataggtcacttttggttttcccccctgt |
54354192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 240 - 310
Target Start/End: Original strand, 3672589 - 3672659
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgact |
310 |
Q |
| |
|
|||||| || ||| ||||| |||||||||||| | || |||||||||||||||||||||||||| |||||| |
|
|
| T |
3672589 |
ccagctaacagtgtattttcgctgatgtggcacgctgagtcacctttttctgatgacgtggcgcgctgact |
3672659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 9136460 - 9136406
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| |||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
9136460 |
ggttaataggcatttatcccctgtaatatagatcacttttggttttgccccctgt |
9136406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 54353482 - 54353556
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||| |||| ||| |||||||||||| | || |||||| ||||||||||||||||||| |||| ||||| |
|
|
| T |
54353482 |
ccagctgactatgcactttcgctgatgtggcacgctgagtcaccgttttctgatgacgtggcgcgctgagtgtat |
54353556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 244 - 301
Target Start/End: Complemental strand, 2658026 - 2657969
Alignment:
| Q |
244 |
ctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggc |
301 |
Q |
| |
|
||||||||| ||||| ||||||||| |||| || |||||||||||||||||||||||| |
|
|
| T |
2658026 |
ctgactgtgtattttcgctgatgtgacatgctgagtcacctttttctgatgacgtggc |
2657969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 113 - 158
Target Start/End: Complemental strand, 21798632 - 21798587
Alignment:
| Q |
113 |
ataattgtttgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
21798632 |
ataatggtttgggttaataggtctttatcccctgtaatataggtca |
21798587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 50879909 - 50879962
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| ||||||||||||||| |||| |
|
|
| T |
50879909 |
gggttaataggtctttacttcctgtaatataggccacttttggttttgctccct |
50879962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 122 - 174
Target Start/End: Original strand, 15694458 - 15694510
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
15694458 |
tgggttaataggcctttaccccctgtaatatacaccacttttggttttgcccc |
15694510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 17289742 - 17289798
Alignment:
| Q |
123 |
gggttaataggtcttta-ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||| ||||||| ||||||||||| |||||||||| |||||||| |
|
|
| T |
17289742 |
gggttaataggtctttatccccctgaaatataggtcatttttggttttcccccctgt |
17289798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 17290032 - 17289980
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |||| ||||| |||||| |
|
|
| T |
17290032 |
ggttaataggtctttaccccctataatataggtcattttttgttttcccccct |
17289980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 121 - 176
Target Start/End: Complemental strand, 21780415 - 21780359
Alignment:
| Q |
121 |
ttgggttaataggtctttacc-ccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| || ||||||| |||||| |
|
|
| T |
21780415 |
ttgggttaataggtctttacctccctgtaatataggtcatttctggtttttccccct |
21780359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 21798332 - 21798388
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| || ||||||| |||||||| |
|
|
| T |
21798332 |
gggttaataggtctttacccccctgtaatataggtcatttctggttttaccccctgt |
21798388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 134 - 178
Target Start/End: Complemental strand, 31110529 - 31110485
Alignment:
| Q |
134 |
tctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
31110529 |
tctttaccccctgtaatataggtcatttttggtttttccccctgt |
31110485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 34025914 - 34025966
Alignment:
| Q |
123 |
gggttaataggtctttaccccct-gtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
34025914 |
gggttaatagacctttacccccttgtaatataggtcacttttggttttgcccc |
34025966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 66 - 106
Target Start/End: Original strand, 37857041 - 37857081
Alignment:
| Q |
66 |
ttgcctcctattgaactcaacatgagagttctgaaatctat |
106 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37857041 |
ttgcctcctgttgaactcaacatgagagttctgaaatctat |
37857081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 46094298 - 46094242
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| || |||||| |||||||| |
|
|
| T |
46094298 |
tgggttaataggtctttaccctctgtaatataggtcatttccggtttttccccctgt |
46094242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 7272263 - 7272322
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| | ||| |||||| |||||||| |
|
|
| T |
7272263 |
tttgggttaataggtctttacccccttgtaatataggttattttcggttttcccccctgt |
7272322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 244 - 303
Target Start/End: Complemental strand, 9136343 - 9136284
Alignment:
| Q |
244 |
ctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgc |
303 |
Q |
| |
|
|||| |||||||||| |||||||||| ||| || |||||||||||| ||||||||||||| |
|
|
| T |
9136343 |
ctgaatgtgcattttcgctgatgtggtatgctgtgtcacctttttcggatgacgtggcgc |
9136284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 11862083 - 11862028
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
11862083 |
gggttaataggcctttaccctttgtaatatagaacacttttggttttgccccctgt |
11862028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 13334823 - 13334878
Alignment:
| Q |
124 |
ggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| || ||||||| |||||||| |
|
|
| T |
13334823 |
ggttaataggtctttacccccctgtaatataggtcatttctggttttcccccctgt |
13334878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 19876031 - 19875972
Alignment:
| Q |
120 |
tttgggttaataggtcttta-ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||| |||||| || ||||| |
|
|
| T |
19876031 |
tttgggttaataggtctttaaccccctgtaatataggtcattttcggtttttcctcctgt |
19875972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 20125475 - 20125440
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
20125475 |
gggttaataggtctttaccccctgtaatataggtca |
20125440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 22272930 - 22272985
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| ||| |||||| || ||||| |
|
|
| T |
22272930 |
gggttaataggtttttaccccctgtaatataggtcattttcggttttccctcctgt |
22272985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 37273452 - 37273417
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37273452 |
gggttaataggtctttaccccctgtaatataggtca |
37273417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 236 - 303
Target Start/End: Original strand, 43860622 - 43860689
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgc |
303 |
Q |
| |
|
|||| |||||||||||||||||| |||||||||||| | || ||||| |||||| |||||||||||| |
|
|
| T |
43860622 |
tagatcagctgactgtgcattttcgctgatgtggcacgctgattcacccttttctaatgacgtggcgc |
43860689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 937772 - 937845
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||||| ||||| |||||| ||||||||||| ||| ||||||| |
|
|
| T |
937772 |
ccagctgactgtacatttttgctgatgtgacatgttccgtca-ttttttcggatgacgtggcatactaactgtat |
937845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 938930 - 938852
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||| |||||||||||||| | |||||||| |||||| || |||||||||||| |||||||||| ||||||| |||| |
|
|
| T |
938930 |
tagagcagctgactgtgcactattgctgatatggcatattatgtcacctttttcgaatgacgtggcacactgacagtat |
938852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 53 - 107
Target Start/End: Complemental strand, 1394178 - 1394124
Alignment:
| Q |
53 |
cgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctatt |
107 |
Q |
| |
|
||||| |||| | |||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
1394178 |
cgaccccattagcttgcctcctattgaactcgacatgagagttctgaaaactatt |
1394124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 41 - 107
Target Start/End: Original strand, 1479277 - 1479343
Alignment:
| Q |
41 |
ctaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctatt |
107 |
Q |
| |
|
|||| ||||||| |||| |||| |||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
1479277 |
ctaacttgtgagtgaccccatttacttgcctcctattgaactcgatatgagagttctgaaatctatt |
1479343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 66 - 112
Target Start/End: Complemental strand, 16889182 - 16889136
Alignment:
| Q |
66 |
ttgcctcctattgaactcaacatgagagttctgaaatctattaacta |
112 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16889182 |
ttgcctccgactgaactcaacatgagagttctgaaatctatcaacta |
16889136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 24700293 - 24700347
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||| || |||||| |||| |||||||||||||||||||||| |||||||| |
|
|
| T |
24700293 |
ggttaataagtttttacctcctgcaatataggtcacttttggttttaccccctgt |
24700347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 35539604 - 35539650
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||| |||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
35539604 |
gggtcaataggtctttatcccctgtaatataggtcatttttggtttt |
35539650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 38656112 - 38656066
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||| ||||| |
|
|
| T |
38656112 |
gggttaataggtctttaccccctataatataggtcattttttgtttt |
38656066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 240 - 302
Target Start/End: Complemental strand, 41332679 - 41332617
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcg |
302 |
Q |
| |
|
||||||||||||||||||| |||||||||||| || |||| | |||||||||||||||||| |
|
|
| T |
41332679 |
ccagctgactgtgcattttcgctgatgtggcacactgagtcatcgttttctgatgacgtggcg |
41332617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 39 - 97
Target Start/End: Original strand, 43989302 - 43989360
Alignment:
| Q |
39 |
aactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttct |
97 |
Q |
| |
|
|||||||| |||||||||||||| | |||||||||||||||||| ||||||| ||||| |
|
|
| T |
43989302 |
aactaattcatgagcgacctcattggcttgcctcctattgaactcgacatgagcgttct |
43989360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 50727590 - 50727636
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| || ||||||| |
|
|
| T |
50727590 |
gggttaataggtttttaccccctgtaatataggtcatttctggtttt |
50727636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 50735604 - 50735650
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| || ||||||| |
|
|
| T |
50735604 |
gggttaataggtttttaccccctgtaatataggtcatttctggtttt |
50735650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 51162077 - 51162131
Alignment:
| Q |
123 |
gggttaataggtcttta-ccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
||||||||||| ||||| |||||| |||||||||||||||||| ||||||||||| |
|
|
| T |
51162077 |
gggttaataggcctttatccccctataatataggtcacttttgattttgccccct |
51162131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 240 - 314
Target Start/End: Complemental strand, 54054324 - 54054250
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| || |||||||||| ||||| |||| | |||||||||| |
|
|
| T |
54054324 |
ccagctgactgtgcatttttactgatgtggcatgatgtctcaccttttttggatgaggtggtgtgctgactgtat |
54054250 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 125 - 158
Target Start/End: Original strand, 27579516 - 27579549
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27579516 |
gttaataggtctttaccccctgtaatataggtca |
27579549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 41332798 - 41332749
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||| |||||| ||| ||||||||||||||||||||||| |
|
|
| T |
41332798 |
tttgggttaataggcttttacctcctataatataggtcacttttggtttt |
41332749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 249 - 314
Target Start/End: Complemental strand, 47766484 - 47766419
Alignment:
| Q |
249 |
tgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||| ||||||||| || | | |||||| |||||||||||||||||||||||| ||||| |
|
|
| T |
47766484 |
tgtgcattttcgctgatgtgacacgctaagtcaccgttttctgatgacgtggcgcactgattgtat |
47766419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 126 - 170
Target Start/End: Original strand, 937660 - 937704
Alignment:
| Q |
126 |
ttaataggtctttaccccctgtaatataggtcacttttggttttg |
170 |
Q |
| |
|
|||||| | ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
937660 |
ttaataagcctttaccccttgtaatataggtcacttttggttttg |
937704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 171
Target Start/End: Original strand, 11861903 - 11861951
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgc |
171 |
Q |
| |
|
|||||||| || |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
11861903 |
gggttaatgggcctttaccccctgtaatatagagcacttttggttttgc |
11861951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 15695236 - 15695180
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
15695236 |
gggttaataggtctttacccccctgtattatacaccacttttggttttgccccctgt |
15695180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 17696030 - 17695974
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| |||||||||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
17696030 |
gggttaatagtcctttacccccctgtaatataagacacttttggttttgccccctgt |
17695974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 66 - 110
Target Start/End: Original strand, 19315961 - 19316005
Alignment:
| Q |
66 |
ttgcctcctattgaactcaacatgagagttctgaaatctattaac |
110 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| || ||||| |
|
|
| T |
19315961 |
ttgcctcctattgaactcgacatgagagttctgaaaactgttaac |
19316005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 21246476 - 21246528
Alignment:
| Q |
123 |
gggttaataggtctttac-cccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| ||| |||||| |||| |
|
|
| T |
21246476 |
gggttaataggtctttacacccctgtaatataggtcattttcggttttccccc |
21246528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 9 - 116
Target Start/End: Complemental strand, 46078555 - 46078449
Alignment:
| Q |
9 |
atggggactatgattagatagggttgtctaaactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctg-aaatctatt |
107 |
Q |
| |
|
|||||| ||| |||||| |||||| |||||| ||| | ||||||||||| ||| ||||||||| | |||| ||| |||||||||||||| ||||||||| |
|
|
| T |
46078555 |
atgggggctaggattaggtagggt-gtctaagttaactcgtgagcgacct-atttgtttgcctcttgttgagctcgacatgagagttctgaaaatctatt |
46078458 |
T |
 |
| Q |
108 |
aactaataa |
116 |
Q |
| |
|
|||| |||| |
|
|
| T |
46078457 |
aactgataa |
46078449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 240 - 272
Target Start/End: Complemental strand, 48030216 - 48030184
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcat |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48030216 |
ccagctgactgtgcatttttgctgatgtggcat |
48030184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 51353491 - 51353435
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| || ||||||| |||||||| |
|
|
| T |
51353491 |
tgggttaatagtgatttaccccctgtaatataggtcatttctggttttcccccctgt |
51353435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 122 - 158
Target Start/End: Original strand, 51965371 - 51965407
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
51965371 |
tgggttaataggtctttactccctgtaatataggtca |
51965407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 30 - 93
Target Start/End: Complemental strand, 1311218 - 1311155
Alignment:
| Q |
30 |
ggttgtctaaactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagag |
93 |
Q |
| |
|
|||||||| |||||| | ||||||||||||||| || ||||||||| ||||||||||||||| |
|
|
| T |
1311218 |
ggttgtctgaactaactcgtgagcgacctcattgacttacctcctattaaactcaacatgagag |
1311155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 236 - 271
Target Start/End: Original strand, 2657262 - 2657297
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggca |
271 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
2657262 |
tagaccagctgactgtgcattttcgctgatgtggca |
2657297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 178
Target Start/End: Original strand, 3475498 - 3475541
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| |||||||| |
|
|
| T |
3475498 |
ctttaccccctgtaatataggtcattttttgttttcccccctgt |
3475541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 143 - 178
Target Start/End: Complemental strand, 4433024 - 4432989
Alignment:
| Q |
143 |
cctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4433024 |
cctgtaatatagatcacttttggttttgccccctgt |
4432989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 6439185 - 6439240
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||| |||||| | |||||| |
|
|
| T |
6439185 |
gggttaatagtgctttaccccctgtaatataggtcattttcggttttacaccctgt |
6439240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 7514582 - 7514637
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| ||||||| ||||||| | ||||||||||||||||||| ||||| |
|
|
| T |
7514582 |
gggttaataggcctttacctcctgtaaattgggtcacttttggttttgcctcctgt |
7514637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 9410343 - 9410284
Alignment:
| Q |
120 |
tttgggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||| |||||||||||||| ||||||| |
|
|
| T |
9410343 |
tttgggttaatagtgttttacccctctgtaatatagggcacttttggttttgtcccctgt |
9410284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 178
Target Start/End: Original strand, 12878687 - 12878730
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| |||||||| |
|
|
| T |
12878687 |
ctttaccccctgtaatataggtcattttttgttttcccccctgt |
12878730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 178
Target Start/End: Complemental strand, 13033171 - 13033128
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| |||||||| |
|
|
| T |
13033171 |
ctttaccccctgtaatataggtcattttttgtttttccccctgt |
13033128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 110 - 169
Target Start/End: Original strand, 13741406 - 13741465
Alignment:
| Q |
110 |
ctaataattgtttgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||| ||||||||| |||||||| ||||||||| |||||||| | ||||||||||||| |
|
|
| T |
13741406 |
ctaattattgtttggattaataggcctttaccccacgtaatatatgacacttttggtttt |
13741465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 178
Target Start/End: Complemental strand, 15782556 - 15782513
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||| |||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
15782556 |
ctttatcccctgtaatataggtcatttttggtttttccccctgt |
15782513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 16493518 - 16493553
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |
|
|
| T |
16493518 |
gggttaataggtctttacctcctgtaatataggtca |
16493553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 178
Target Start/End: Complemental strand, 20514932 - 20514889
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| |||||||| |
|
|
| T |
20514932 |
ctttaccccctgtaatataggtcattttttgttttcccccctgt |
20514889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 77 - 112
Target Start/End: Original strand, 23059423 - 23059458
Alignment:
| Q |
77 |
tgaactcaacatgagagttctgaaatctattaacta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
23059423 |
tgaactcaacatgagagttctgaaatctatcaacta |
23059458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 35539837 - 35539802
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35539837 |
gggttaataggtatttaccccctgtaatataggtca |
35539802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 174
Target Start/End: Complemental strand, 36405898 - 36405859
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
36405898 |
ctttaccccctgtaatataggtcatttttggtttttcccc |
36405859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 240 - 299
Target Start/End: Original strand, 44198714 - 44198773
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtg |
299 |
Q |
| |
|
|||||||||||||||||||| ||||||||| || ||||| |||||| || ||||||||| |
|
|
| T |
44198714 |
ccagctgactgtgcatttttagtgatgtggcctgctgcgtaacctttatcggatgacgtg |
44198773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 122 - 164
Target Start/End: Original strand, 45900527 - 45900570
Alignment:
| Q |
122 |
tgggttaataggtcttta-ccccctgtaatataggtcacttttg |
164 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
45900527 |
tgggttaataggtctttacccccctgtaatataggtcatttttg |
45900570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 170
Target Start/End: Complemental strand, 51754257 - 51754210
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttg |
170 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
51754257 |
gggttaatagagctttaccccctgtaatatagggtacttttggttttg |
51754210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 164
Target Start/End: Complemental strand, 145252 - 145210
Alignment:
| Q |
123 |
gggttaataggtcttta-ccccctgtaatataggtcacttttg |
164 |
Q |
| |
|
||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
145252 |
gggttaataggtctttatccccctgtaatataagtcacttttg |
145210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 120 - 170
Target Start/End: Complemental strand, 551970 - 551920
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttg |
170 |
Q |
| |
|
|||||||||||||| ||||||||| | ||||||| |||||||||| ||||| |
|
|
| T |
551970 |
tttgggttaataggcctttaccccttctaatatacgtcacttttgattttg |
551920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 120 - 158
Target Start/End: Complemental strand, 3525928 - 3525890
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
3525928 |
tttgggttaataagtctttaccctctgtaatataggtca |
3525890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 4431289 - 4431343
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||| | |||||||||| |||| |
|
|
| T |
4431289 |
tttgggttaatggtgctttaccccctgtaatataggttatttttggttttccccc |
4431343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 236 - 270
Target Start/End: Original strand, 7514682 - 7514716
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggc |
270 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
7514682 |
tagaccaactgactgtgcatttttgctgatgtggc |
7514716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 136 - 178
Target Start/End: Original strand, 13032900 - 13032942
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| | |||||| |
|
|
| T |
13032900 |
tttaccccctgtaatataggtcatttttggttttcctccctgt |
13032942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 13128482 - 13128436
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||| ||||||| || ||||||||||||||||||||||| |
|
|
| T |
13128482 |
gggttaataggcatttaccctctataatataggtcacttttggtttt |
13128436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 15157124 - 15157078
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||| || ||||||| |
|
|
| T |
15157124 |
gggttaacaggtcttcaccccctgtaatataggtcatttctggtttt |
15157078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 140 - 178
Target Start/End: Original strand, 15522716 - 15522754
Alignment:
| Q |
140 |
ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
15522716 |
ccccctgtaatataggtcatttttggttttcccccctgt |
15522754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 136 - 178
Target Start/End: Complemental strand, 27450140 - 27450098
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||| |||| |||||||||| |||||||| |
|
|
| T |
27450140 |
tttaccccctgtaatatatgtcatttttggttttcccccctgt |
27450098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 111 - 157
Target Start/End: Complemental strand, 27627051 - 27627005
Alignment:
| Q |
111 |
taataattgtttgggttaataggtctttaccccctgtaatataggtc |
157 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
27627051 |
taataattttttgggttaatagtgttttaccccctgtaatataggtc |
27627005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 135 - 169
Target Start/End: Complemental strand, 35370433 - 35370399
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
35370433 |
ctttaccccctgtaatataggtcatttttggtttt |
35370399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 44199909 - 44199856
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| ||||| || ||||||||| |||||||||||||||||||||||| |
|
|
| T |
44199909 |
ggttaataggcctttatcct-tgtaatatacgtcacttttggttttgccccctgt |
44199856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 49552127 - 49552201
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||| ||| ||||||||| ||||||||| || ||| | |||| ||||||||||||||||| | |||||||||| |
|
|
| T |
49552127 |
ccagccgaccgtgcattttcgctgatgtgacacattgagacaccgttttctgatgacgtggcacgctgactgtat |
49552201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 50719969 - 50719911
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| ||| |||||| || ||||| |
|
|
| T |
50719969 |
tttgggttaatagtgctttaccccctataatataggtcattttcggttttccctcctgt |
50719911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 51396159 - 51396205
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||| || ||||||| |
|
|
| T |
51396159 |
gggttaataggtctttatcccctgtaatataagtcatttctggtttt |
51396205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 122 - 158
Target Start/End: Complemental strand, 5402056 - 5402019
Alignment:
| Q |
122 |
tgggttaataggtctttaccccc-tgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
5402056 |
tgggttaataggtctttacccccttgtaatataggtca |
5402019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 9791703 - 9791655
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| |||| |||||||||| |
|
|
| T |
9791703 |
tttgggttaat-ggtctttaccccccgtaatataagtcatttttggtttt |
9791655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 249 - 298
Target Start/End: Original strand, 12759368 - 12759417
Alignment:
| Q |
249 |
tgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgt |
298 |
Q |
| |
|
|||||||||| ||||||||| |||||| |||||||||||||||| |||| |
|
|
| T |
12759368 |
tgtgcattttcgctgatgtgaaatgttgtgtcacctttttctgataacgt |
12759417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 124 - 169
Target Start/End: Original strand, 39865016 - 39865061
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||| ||||||||| | ||||||||| ||||||||||||||| |
|
|
| T |
39865016 |
ggttaataagtctttacctcttgtaatataagtcacttttggtttt |
39865061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 49629635 - 49629687
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||| |||||||||||||| ||||| |
|
|
| T |
49629635 |
gggttaatagacctttaccccctgtaa-ataggacacttttggttttgtcccct |
49629687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 243 - 295
Target Start/End: Original strand, 144332 - 144384
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatga |
295 |
Q |
| |
|
|||||| ||||||||||||| |||||||||| || ||| ||||||||| |||| |
|
|
| T |
144332 |
gctgacggtgcatttttgctaatgtggcatgatgtgtcgcctttttctaatga |
144384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 5401761 - 5401797
Alignment:
| Q |
123 |
gggttaataggtcttta-ccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
5401761 |
gggttaataggtctttacccccctgtaatataggtca |
5401797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 7913488 - 7913432
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||| ||| |||||| |||||||| |
|
|
| T |
7913488 |
tgggttaatagtgttttaccccctgtaatatatgtcattttcggttttaccccctgt |
7913432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 171
Target Start/End: Original strand, 14183611 - 14183659
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgc |
171 |
Q |
| |
|
|||||||||| |||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
14183611 |
gggttaatagtgttttaccccctctaatatagggcacttttggttttgc |
14183659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 18320753 - 18320717
Alignment:
| Q |
123 |
gggttaataggtctttac-cccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18320753 |
gggttaataggtctttacccccctgtaatataggtca |
18320717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 18454192 - 18454228
Alignment:
| Q |
123 |
gggttaataggtcttta-ccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18454192 |
gggttaataggtctttacccccctgtaatataggtca |
18454228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 18454487 - 18454451
Alignment:
| Q |
123 |
gggttaataggtctttac-cccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
18454487 |
gggttaataggtctttacccccctgtaatataggtca |
18454451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 135 - 171
Target Start/End: Original strand, 44198610 - 44198646
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgc |
171 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
44198610 |
ctttaccccctgtaatatagaccacttttggttttgc |
44198646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 125 - 169
Target Start/End: Original strand, 47765284 - 47765328
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||| |||| |||||| |||||||||||||||||||||| |
|
|
| T |
47765284 |
gttaataggcttttatcccctgcaatataggtcacttttggtttt |
47765328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 54053569 - 54053625
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||| | ||||| ||| ||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
54053569 |
gggttaataagcctttaaccctctgtaatataggttacttttgattttgccccctgt |
54053625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 67; Significance: 1e-29; HSPs: 127)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 5218981 - 5218903
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
5218981 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcatcacctttttcggatgacgtggcgcgctgactgtat |
5218903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 45865597 - 45865519
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
45865597 |
tagaccagctgactgtgcatttttgctgatgtggcatgatgcgtcacctttttcggatgacgtggcgcgctgactgtat |
45865519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 240 - 314
Target Start/End: Complemental strand, 3766657 - 3766583
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||| || |||||||||| |
|
|
| T |
3766657 |
ccagctgactgtgcatttttgctgatgtggcatgttgtgtcacctttttcggatgacgtggtgcgctgactgtat |
3766583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 24757934 - 24757856
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||| ||||||||||||||| ||| | ||||||| |||||||||| |
|
|
| T |
24757934 |
tagaccagctgactgtgcgtttttgctgatgtggcatgctgcgtcacctttttcggataatgtggcgcgctgactgtat |
24757856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 123 - 314
Target Start/End: Complemental strand, 1594181 - 1593991
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnntt-tattcggtccttgtnnnnnnnttttgttt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||| || ||||||||||||| |||||||| |
|
|
| T |
1594181 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcctcctgcaaaaaaaaaaatttggattcggtccttgtaaattttttttgttt |
1594082 |
T |
 |
| Q |
222 |
tagaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
| ||||| |||||||||||||||||||||||||||||| |||||| ||||||| ||||||| ||||||||||||| ||||| |||| |
|
|
| T |
1594081 |
tggaaaa-cccccctagaccagctgactgtgcatttttgctgatatggcat-atgcgtcagctttttcggatgacgtggcgcgctgaccgtat |
1593991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 48 - 116
Target Start/End: Complemental strand, 12980788 - 12980720
Alignment:
| Q |
48 |
gtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctattaactaataa |
116 |
Q |
| |
|
|||||||||| |||||||||||||||| |||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
12980788 |
gtgagcgaccccattcgtttgcctcctgttgaactcgacatgagagttctgaaatctattagctaataa |
12980720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 236 - 302
Target Start/End: Complemental strand, 27159330 - 27159264
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcg |
302 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
27159330 |
tagactagctgactgtgcatttttgctgatgtggcatgctgcgtcaccttttttggatgacgtggcg |
27159264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 45864542 - 45864620
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||| |||||| |||| ||||||||||||| ||||| |||| |
|
|
| T |
45864542 |
tagaccagctgactgtgcatttttgcagatgtggcatgctgcatcacctctttcggatgacgtggcgcgctgacagtat |
45864620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 239 - 314
Target Start/End: Original strand, 1589502 - 1589577
Alignment:
| Q |
239 |
accagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| | |||| ||||||||||||| || ||||||| |
|
|
| T |
1589502 |
accagctgactgtgcatttttgctgatgtggcatgctgcgtcatcctttttggatgacgtggcgctcttactgtat |
1589577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 9553400 - 9553455
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
9553400 |
gggttaataggtctttaccccctgtaatatagggcacttttggttttgcctcctgt |
9553455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 48168850 - 48168905
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
48168850 |
gggttaataggtctttaccctctgtaatatagggcacttttggttttgccccctgt |
48168905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 13279477 - 13279419
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
13279477 |
tttgggttaataggtctttaccccctgtaatataggtcattttcggtttttccccctgt |
13279419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 113 - 178
Target Start/End: Complemental strand, 17764767 - 17764701
Alignment:
| Q |
113 |
ataattgtttgggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||| ||||||||||||||||||||| || |||||||||||| |||||||||||||||||||||| |
|
|
| T |
17764767 |
ataattttttgggttaataggtctttactccactgtaatatagggcacttttggttttgccccctgt |
17764701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 17763336 - 17763392
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
17763336 |
gggttaataggtctttacccctctgtaatataggacacttttggttttgccccctgt |
17763392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 41 - 116
Target Start/End: Complemental strand, 20492545 - 20492470
Alignment:
| Q |
41 |
ctaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctattaactaataa |
116 |
Q |
| |
|
|||||| |||||||||| ||||| |||||||||||| ||||| | ||||||||||| |||||||||||||||||| |
|
|
| T |
20492545 |
ctaattcgtgagcgaccctattcgcttgcctcctattaaactcgagatgagagttctaaaatctattaactaataa |
20492470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 123 - 177
Target Start/End: Original strand, 34158058 - 34158113
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctg |
177 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
34158058 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctg |
34158113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 125 - 178
Target Start/End: Original strand, 1589387 - 1589441
Alignment:
| Q |
125 |
gttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
1589387 |
gttaataggcctttacccccctgtaatataggtcacttttggttttgccccctgt |
1589441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 5217879 - 5217957
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| | |||| |||||| |||||| ||||||||| |
|
|
| T |
5217879 |
tagaccagctgactgtgcatttttgctgatgtggcatgttggatcagcctttttggatgacatggcgcgatgactgtat |
5217957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 5909710 - 5909768
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| || ||||||| |||||||| |
|
|
| T |
5909710 |
tttgggttaataggtctttaccccatgtaatataggtcatttctggtttttccccctgt |
5909768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 9351246 - 9351320
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||| ||||| |||||||||||||| || ||||||||||| |||| | ||||||| |||||||||| |
|
|
| T |
9351246 |
ccagctgactgtgtattttcgctgatgtggcatgctgagtcacctttttatgataatgtggcgcgctgactgtat |
9351320 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 19272506 - 19272460
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
19272506 |
gggttaataggtctttaccccctgtaatataggtcatttttggtttt |
19272460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 21858452 - 21858374
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||| ||||||||||| ||||| ||||||||| || | || |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
21858452 |
tagactagctgactgtgtattttcgctgatgtgacacgctgagtcacctttttctgatgacgtggcgcgttgactgtat |
21858374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 240 - 314
Target Start/End: Complemental strand, 23162148 - 23162074
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||| |||||||| |||||||||||| |||| ||| |||||||||||| | ||||||| |||||||||| |
|
|
| T |
23162148 |
ccagctgactatgcattttcgctgatgtggcacgttgagtcgcctttttctgataatgtggcgcgctgactgtat |
23162074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 33758163 - 33758085
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||| | || |||| | ||||||||||||||| ||| |||||||||| |
|
|
| T |
33758163 |
tagaccagctgactgtgtattttcgctgatgtggcacgctgagtcatcgttttctgatgacgtgacgcgctgactgtat |
33758085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 38193254 - 38193196
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| || ||||||| ||||||| |
|
|
| T |
38193254 |
tttgggttaataggtctttaccccctgtaatataggtcatttctggttttctcccctgt |
38193196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 125 - 171
Target Start/End: Original strand, 48896481 - 48896527
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggttttgc |
171 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48896481 |
gttaataggtctttacctcctgtaatataggtcacttttggttttgc |
48896527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 241 - 314
Target Start/End: Complemental strand, 9351609 - 9351536
Alignment:
| Q |
241 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||||| |||| |||| | ||||||||||| ||||| | |||||||||| |
|
|
| T |
9351609 |
cagctgactgtgcattttcgctgatgtggcacgttgagtcatcgttttctgatgatgtggcacgctgactgtat |
9351536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 21237402 - 21237349
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
21237402 |
gggttaataggcatttaccccctataatataggtcacttttggttttgccccct |
21237349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 33757410 - 33757463
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
33757410 |
gggttaatagatctttaccccctgtaatataggtcacttttgattttcccccct |
33757463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 5219094 - 5219038
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||| ||||||||||||| |
|
|
| T |
5219094 |
gggttaataggcctttacccccctgtaatataggtcacttttgattttgccccctgt |
5219038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 122 - 174
Target Start/End: Original strand, 23371448 - 23371500
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| || ||||||| |||| |
|
|
| T |
23371448 |
tgggttaataggtctttaccccctgtaatataggtcatttatggttttccccc |
23371500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 242 - 314
Target Start/End: Complemental strand, 23806829 - 23806757
Alignment:
| Q |
242 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||| |||||||||||| |||||||||||| | || |||||| ||||||||||| ||||||| |||||||||| |
|
|
| T |
23806829 |
agctaactgtgcattttcgctgatgtggcacgctgagtcaccattttctgatgatgtggcgcgctgactgtat |
23806757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 120 - 171
Target Start/End: Original strand, 8174881 - 8174932
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgc |
171 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| || |||||||||||| |
|
|
| T |
8174881 |
tttgggctaataggtctttaccccctgtaatatagggcatttttggttttgc |
8174932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 14554505 - 14554450
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||| |||| ||||| |||||||| |
|
|
| T |
14554505 |
gggttaataggcctttaccccctgtaatataggtcattttttgttttcccccctgt |
14554450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 48945184 - 48945235
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
48945184 |
gggttaataggtttttaccctctgtaatataggtcatttttggttttgcccc |
48945235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 49 - 95
Target Start/End: Original strand, 10325120 - 10325166
Alignment:
| Q |
49 |
tgagcgacctcattcgtttgcctcctattgaactcaacatgagagtt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
10325120 |
tgagcgacctcattcgtttgcctcctattaaactcgacatgagagtt |
10325166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 49 - 107
Target Start/End: Complemental strand, 21118452 - 21118394
Alignment:
| Q |
49 |
tgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctatt |
107 |
Q |
| |
|
|||| ||||||||| | |||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
21118452 |
tgagtgacctcattagcttgcctcctattgaactcgacatgagagttctgaaaactatt |
21118394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 24758049 - 24757995
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| ||||| ||||||||||||||| |
|
|
| T |
24758049 |
gggttaataggtctttacccccctgtaatatagatcactattggttttgccccct |
24757995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 31928595 - 31928517
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||| || |||||||||||||||| |||| | ||||||| ||||| |
|
|
| T |
31928595 |
tagaccagctgactgtgtattttcgctgatgtggcacactgagtcacctttttctgattacgtagtgcactgattgtat |
31928517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 120 - 158
Target Start/End: Complemental strand, 39580226 - 39580188
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39580226 |
tttgggttaataggtctttaccccctgtaatataggtca |
39580188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 122 - 164
Target Start/End: Original strand, 42202160 - 42202202
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttg |
164 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
42202160 |
tgggttaataggtctttaccccctgcaatataggtcacttttg |
42202202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 120 - 169
Target Start/End: Original strand, 19979648 - 19979697
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| || ||||||| |
|
|
| T |
19979648 |
tttgggttaataggtctttaccccctgtaatataagtcatttctggtttt |
19979697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 244 - 309
Target Start/End: Complemental strand, 21237286 - 21237221
Alignment:
| Q |
244 |
ctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgac |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||| || |||||||| || |||||||||| || ||||| |
|
|
| T |
21237286 |
ctgactgtgcatttttgctgatgtggcatgctgtgtcaccttcgtcggatgacgtggtgcgctgac |
21237221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 245 - 314
Target Start/End: Original strand, 33757472 - 33757541
Alignment:
| Q |
245 |
tgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||| ||||| | |||||||||| | || ||||||||||||||||||||||||| |||||||||| |
|
|
| T |
33757472 |
tgactgtgtattttcgttgatgtggcacgctgaatcacctttttctgatgacgtggcgcgctgactgtat |
33757541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 245 - 314
Target Start/End: Original strand, 42202282 - 42202351
Alignment:
| Q |
245 |
tgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||| ||||| |||||||||||| | || ||||||||||| |||||||||| ||| |||||||||| |
|
|
| T |
42202282 |
tgactgtgtattttcgctgatgtggcacgatgagtcacctttttatgatgacgtgacgcgctgactgtat |
42202351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 241 - 314
Target Start/End: Complemental strand, 42203075 - 42203002
Alignment:
| Q |
241 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||| |||||||||| | | || |||||| ||||| |||||||||| || |||||||||| |
|
|
| T |
42203075 |
cagctgactgtgcattttcgctgatgtggtacgctgagtcaccgttttccgatgacgtggtgcgctgactgtat |
42203002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 236 - 308
Target Start/End: Complemental strand, 48946246 - 48946176
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactga |
308 |
Q |
| |
|
||||||||||||| ||||| || |||||||||||||| ||||||||||||||| ||||| ||||||| |||| |
|
|
| T |
48946246 |
tagaccagctgaccgtgcaatt--gctgatgtggcatgctgcgtcacctttttcggatgaggtggcgcgctga |
48946176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 5766637 - 5766693
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| || |||||| |||||||| |
|
|
| T |
5766637 |
tgggttaatatgtctttaccccctgtaatataggtcatttccggtttttccccctgt |
5766693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 9554317 - 9554261
Alignment:
| Q |
123 |
gggttaataggtctttaccc-cctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
9554317 |
gggttaataaatctttaccctcctgtaatatagggcacttttggttttgccccctgt |
9554261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 11056729 - 11056781
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||| |||||||||| | |||||||||||||||||| |
|
|
| T |
11056729 |
gggttaataggtctttacccccctgtaatataaggcacttttggttttgcccc |
11056781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 13286923 - 13286867
Alignment:
| Q |
123 |
gggttaataggtctttaccccct-gtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| || ||||||| |||||||| |
|
|
| T |
13286923 |
gggttaataggtctttacccccttgtaatataggtcatttctggttttcccccctgt |
13286867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 23161100 - 23161152
Alignment:
| Q |
123 |
gggttaataggtctttaccc-cctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||||||||||| |||| |
|
|
| T |
23161100 |
gggttaataggtctttaccctcctgtaatataggttacttttggtttttcccc |
23161152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 45865709 - 45865653
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| || ||||||| ||||||||||||||||||||||||| |||||||| |
|
|
| T |
45865709 |
gggttaataggcctctacccccctgtaatataggtcacttttggttttaccccctgt |
45865653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 121 - 169
Target Start/End: Complemental strand, 48104787 - 48104739
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||| |||||| |
|
|
| T |
48104787 |
ttgggttaataggtctttacctcctgtaatataggtcattttcggtttt |
48104739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 1832036 - 1831985
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |||||||| |||| |||| |
|
|
| T |
1832036 |
gggttaatagggctttaccccctgtaatatagggcacttttgattttccccc |
1831985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 6269528 - 6269563
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
6269528 |
gggttaataggtctttaccccctgtaatataggtca |
6269563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 16902393 - 16902343
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||||| |||| |
|
|
| T |
16902393 |
gggttaataggtctttacccc-tgtaatataggtcatttttggtttttcccc |
16902343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 23784584 - 23784619
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
23784584 |
gggttaataggtctttaccccctgtaatataggtca |
23784619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 24555958 - 24555907
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||| || ||||||| |||| |
|
|
| T |
24555958 |
gggttaataggtttttaccccctgtaatataggtcatttctggtttttcccc |
24555907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 42509095 - 42509040
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
42509095 |
gggttaatagtgttttaccctctgtaatatagggcacttttggttttgccccctgt |
42509040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 120 - 158
Target Start/End: Complemental strand, 3307736 - 3307698
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
3307736 |
tttgggttaataagtctttaccccctgtaatataggtca |
3307698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 124 - 158
Target Start/End: Complemental strand, 13797667 - 13797633
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
13797667 |
ggttaataggtctttaccccctgtaatataggtca |
13797633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 136 - 178
Target Start/End: Original strand, 19336056 - 19336098
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
19336056 |
tttaccccctgtaatataggtcatttttggttttcccccctgt |
19336098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 21298302 - 21298256
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| |||||||||| |
|
|
| T |
21298302 |
gggttaataggtctttatcccttgtaatataggtcatttttggtttt |
21298256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 23806226 - 23806280
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||| |||| |||| |
|
|
| T |
23806226 |
tttgggttaataggcttttaccccctgcaatataggtcacttttgatttttcccc |
23806280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 24845638 - 24845684
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| ||| |||||| |
|
|
| T |
24845638 |
gggttaataggtctttacctcctgtaatataggtcattttcggtttt |
24845684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 26050175 - 26050221
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||| |||||| |
|
|
| T |
26050175 |
gggttaataggtctttaccccctctaatataggtcattttcggtttt |
26050221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 26059534 - 26059580
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||| |||||| |
|
|
| T |
26059534 |
gggttaataggtctttaccccctctaatataggtcattttcggtttt |
26059580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 120 - 173
Target Start/End: Original strand, 38092032 - 38092086
Alignment:
| Q |
120 |
tttgggttaataggtctttac-cccctgtaatataggtcacttttggttttgccc |
173 |
Q |
| |
|
|||||||||||||| | |||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
38092032 |
tttgggttaataggccgttactcccctgtaatataggtcactttcggttttgccc |
38092086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 123 - 156
Target Start/End: Original strand, 9915651 - 9915684
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9915651 |
gggttaataggtctttaccccctgtaatataggt |
9915684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 123 - 156
Target Start/End: Original strand, 9923563 - 9923596
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
9923563 |
gggttaataggtctttaccccctgtaatataggt |
9923596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 123 - 168
Target Start/End: Original strand, 10688458 - 10688503
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttt |
168 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| || |||||| |
|
|
| T |
10688458 |
gggttaataggtctttaccctctgtaatataggtcatttctggttt |
10688503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 124 - 169
Target Start/End: Original strand, 21298015 - 21298060
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||| ||| |||||| |
|
|
| T |
21298015 |
ggttaataggtctttaccccctgtaatataagtcattttcggtttt |
21298060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 123 - 168
Target Start/End: Complemental strand, 35913341 - 35913296
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttt |
168 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| || |||||| |
|
|
| T |
35913341 |
gggttaataggtctttaccccctgtaatatagatcatttctggttt |
35913296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 249 - 314
Target Start/End: Original strand, 38092162 - 38092227
Alignment:
| Q |
249 |
tgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||| |||||||||||| ||| ||||||||||| ||||| |||||| |||||||||| |
|
|
| T |
38092162 |
tgtgcatttttactgatgtggcattatgcatcacctttttcggatgaggtggcgtgctgactgtat |
38092227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 124 - 169
Target Start/End: Original strand, 44568849 - 44568894
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
44568849 |
ggttaatagatctttaccccctgtaatataggtcattttcggtttt |
44568894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 48170316 - 48170264
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||| ||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
48170316 |
gggttaagaggtctttacctcctgtaatata---cacttttggttttgccccctgt |
48170264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 1492760 - 1492816
Alignment:
| Q |
123 |
gggttaataggtctttaccccct-gtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||| |||||||||| |||||||| |
|
|
| T |
1492760 |
gggttaatagtgctttacccccttgtaatataggtcatttttggttttcccccctgt |
1492816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 12814594 - 12814650
Alignment:
| Q |
123 |
gggttaataggtctttac-cccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| || ||||||| ||||||| |
|
|
| T |
12814594 |
gggttaataggtctttactcccctgtaatataggtcatttgtggttttctcccctgt |
12814650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 101
Target Start/End: Complemental strand, 23820580 - 23820528
Alignment:
| Q |
49 |
tgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaa |
101 |
Q |
| |
|
||||||||| |||| | |||||||||||||||||| | ||||||||||||||| |
|
|
| T |
23820580 |
tgagcgaccccattggcttgcctcctattgaactcgatatgagagttctgaaa |
23820528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 24434907 - 24434963
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| ||||||||| || ||||||| ||||||||| |||| |
|
|
| T |
24434907 |
gggttaataggtctttacccccctgtaatatcgggcacttttcgttttgccctctgt |
24434963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 126 - 158
Target Start/End: Original strand, 39065386 - 39065418
Alignment:
| Q |
126 |
ttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39065386 |
ttaataggtctttaccccctgtaatataggtca |
39065418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 1830812 - 1830863
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| ||||||| |||| |||| |
|
|
| T |
1830812 |
gggttaatagggctttaccccctgtaatataggatacttttgattttccccc |
1830863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 10660021 - 10659962
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| | |||||||||| |||||||||||||| |||||||||| |||||||| |
|
|
| T |
10660021 |
tttgggttaatggtgctttacccccctgtaatataggtcatttttggttttcccccctgt |
10659962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 10980653 - 10980618
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10980653 |
gggttaataggtctttaccctctgtaatataggtca |
10980618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 13882603 - 13882638
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
13882603 |
gggttaataggtctttaccctctgtaatataggtca |
13882638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 9 - 112
Target Start/End: Complemental strand, 17852441 - 17852338
Alignment:
| Q |
9 |
atggggactatgattagatagggttgtctaaactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctatta |
108 |
Q |
| |
|
|||||| ||| |||||||||||| || || | |||| | |||||| ||| ||| | |||||||| |||||||||||||||| ||||||||||||| | |
|
|
| T |
17852441 |
atgggggctaagattagatagggctgcctgagctaactcgtgagctaccctatttgcttgcctccggctgaactcaacatgagaattctgaaatctatca |
17852342 |
T |
 |
| Q |
109 |
acta |
112 |
Q |
| |
|
|||| |
|
|
| T |
17852341 |
acta |
17852338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 19410506 - 19410565
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| | || ||||||| ||||||| |
|
|
| T |
19410506 |
tttgggttaataggtctttacccccttgtaatataggttatttctggttttttcccctgt |
19410565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 21444240 - 21444185
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
21444240 |
gggttaatagtgttttaccccctgtaatataggtcattttcggttttaccccctgt |
21444185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 122 - 169
Target Start/End: Complemental strand, 23806948 - 23806901
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
23806948 |
tgggttaatagacctttacccccgataatataggtcacttttggtttt |
23806901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 174
Target Start/End: Complemental strand, 30335427 - 30335388
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
30335427 |
ctttaccccctgtaatataggtcatttttggttttccccc |
30335388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 31186668 - 31186703
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| |
|
|
| T |
31186668 |
gggttaataggtctttaccctctgtaatataggtca |
31186703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 174
Target Start/End: Original strand, 35097601 - 35097640
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
35097601 |
ctttaccccctgtaatataggtcatttttggttttccccc |
35097640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 41 - 120
Target Start/End: Complemental strand, 36677682 - 36677603
Alignment:
| Q |
41 |
ctaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctattaactaataattgt |
120 |
Q |
| |
|
|||| ||||||| |||| ||||||| |||| || |||||||| |||||||||| ||||| ||||||||||| |||||| |
|
|
| T |
36677682 |
ctaacttgtgagtgaccctattcgttcgccttctgttgaactcgacatgagagtgttgaaaactattaactaacaattgt |
36677603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 168
Target Start/End: Complemental strand, 15037463 - 15037417
Alignment:
| Q |
123 |
gggttaataggtctttac-cccctgtaatataggtcacttttggttt |
168 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| || |||||| |
|
|
| T |
15037463 |
gggttaataggtctttacccccctgtaatataggtcatttctggttt |
15037417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 135 - 169
Target Start/End: Original strand, 15108100 - 15108134
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
15108100 |
ctttaccccctgtaatataggtcatttttggtttt |
15108134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 120 - 169
Target Start/End: Original strand, 19272216 - 19272266
Alignment:
| Q |
120 |
tttgggttaataggtctttacc-ccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||| || ||||||| |
|
|
| T |
19272216 |
tttgggttaataggtctttacctccctctaatataggtcatttctggtttt |
19272266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 157
Target Start/End: Complemental strand, 26050460 - 26050426
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtc |
157 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26050460 |
gggttaataggtctttaacccctgtaatataggtc |
26050426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 157
Target Start/End: Complemental strand, 26059819 - 26059785
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtc |
157 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
26059819 |
gggttaataggtctttaacccctgtaatataggtc |
26059785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 111 - 157
Target Start/End: Complemental strand, 41380773 - 41380727
Alignment:
| Q |
111 |
taataattgtttgggttaataggtctttaccccctgtaatataggtc |
157 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
41380773 |
taataattttttgggttaatagtgttttaccccctgtaatataggtc |
41380727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 124 - 158
Target Start/End: Original strand, 45163914 - 45163948
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |
|
|
| T |
45163914 |
ggttaataggtctttaccccttgtaatataggtca |
45163948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 48104510 - 48104563
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| |||| ||||| ||||||| |
|
|
| T |
48104510 |
ggttaataggtctttacccc-tgtaatataggtcattttttgttttctcccctgt |
48104563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 48896595 - 48896672
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||| ||||||||| | ||||||||||||||||||||| | ||| || ||||| ||||| ||| |||||||||||||| |
|
|
| T |
48896595 |
tagagcagctgactatacatttttgctgatgtggcatgctatgtctcc-ttttcggatgatgtgacgcactgactgtat |
48896672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 139 - 172
Target Start/End: Complemental strand, 3766755 - 3766722
Alignment:
| Q |
139 |
accccctgtaatataggtcacttttggttttgcc |
172 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
3766755 |
accccctgtaatataggtcgcttttggttttgcc |
3766722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 121 - 178
Target Start/End: Original strand, 35158181 - 35158238
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||| |||| |||||||||||||||||| ||| |||||| |||||||| |
|
|
| T |
35158181 |
ttgggttaatagtgttttatcccctgtaatataggtcattttcggttttaccccctgt |
35158238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 98
Target Start/End: Original strand, 40901859 - 40901908
Alignment:
| Q |
49 |
tgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctg |
98 |
Q |
| |
|
||||||||| ||| |||||||||||||| ||||| |||||||||||||| |
|
|
| T |
40901859 |
tgagcgaccatattagtttgcctcctattcaactcgacatgagagttctg |
40901908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 135 - 176
Target Start/End: Complemental strand, 44412577 - 44412536
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| |||||| |
|
|
| T |
44412577 |
ctttaccccctgtaatataggtcattttttgttttcccccct |
44412536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 124 - 169
Target Start/End: Complemental strand, 44414133 - 44414089
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||| || ||||||| |
|
|
| T |
44414133 |
ggttaataggtctttacccc-tgtaatataggtcatttatggtttt |
44414089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 126 - 178
Target Start/End: Complemental strand, 45164174 - 45164121
Alignment:
| Q |
126 |
ttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| || ||||||| ||||||| |
|
|
| T |
45164174 |
ttaataggtctttaccccactgtaatataggtcatttctggttttcacccctgt |
45164121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 268
Target Start/End: Original strand, 48945300 - 48945329
Alignment:
| Q |
239 |
accagctgactgtgcatttttgctgatgtg |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
48945300 |
accagctgactgtgcatttttgctgatgtg |
48945329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 1263784 - 1263840
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||| | |||||||||||||||||||| ||| |||| ||||| |||||||| |
|
|
| T |
1263784 |
tgggttaatggtgctttaccccctgtaatatagatcattttttgttttcccccctgt |
1263840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 125 - 173
Target Start/End: Original strand, 8336444 - 8336492
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggttttgccc |
173 |
Q |
| |
|
||||||||| || |||||| ||||||||||| |||||| |||||||||| |
|
|
| T |
8336444 |
gttaatagggctctaccccatgtaatataggacactttcggttttgccc |
8336492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 135 - 175
Target Start/End: Original strand, 10659744 - 10659784
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccc |
175 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||||| ||||| |
|
|
| T |
10659744 |
ctttaccccctgcaatataggtcatttttggttttcccccc |
10659784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 12180892 - 12180856
Alignment:
| Q |
123 |
gggttaataggtcttta-ccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12180892 |
gggttaataggtctttatccccctgtaatataggtca |
12180856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 14079054 - 14079018
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14079054 |
gggttaataggtctttacccccatgtaatataggtca |
14079018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 14389082 - 14389046
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14389082 |
gggttaataggtctttacccccatgtaatataggtca |
14389046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 122 - 158
Target Start/End: Original strand, 15037256 - 15037292
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
15037256 |
tgggttaataggtctttaccccttgtaatattggtca |
15037292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 163
Target Start/End: Complemental strand, 19979935 - 19979895
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcactttt |
163 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||| |||| |
|
|
| T |
19979935 |
gggttaataggtctttaccccctataatatatgtcattttt |
19979895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 24555704 - 24555740
Alignment:
| Q |
123 |
gggttaataggtctttaccc-cctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
24555704 |
gggttaataggtctttaccctcctgtaatataggtca |
24555740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 251 - 299
Target Start/End: Original strand, 25903620 - 25903668
Alignment:
| Q |
251 |
tgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtg |
299 |
Q |
| |
|
||||| ||||||||||||||| | || ||||| |||||||||||||||| |
|
|
| T |
25903620 |
tgcatatttgctgatgtggcacgctgagtcacatttttctgatgacgtg |
25903668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 140 - 176
Target Start/End: Original strand, 28157041 - 28157077
Alignment:
| Q |
140 |
ccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||| |
|
|
| T |
28157041 |
ccccctgtaatataggtcatttttggttttcccccct |
28157077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 244 - 288
Target Start/End: Complemental strand, 28394935 - 28394891
Alignment:
| Q |
244 |
ctgactgtgcatttttgctgatgtggcatgttgcgtcaccttttt |
288 |
Q |
| |
|
|||||| |||||||| |||||||||||| | |||||||||||||| |
|
|
| T |
28394935 |
ctgactatgcattttcgctgatgtggcacgctgcgtcaccttttt |
28394891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 126 - 158
Target Start/End: Complemental strand, 29141211 - 29141179
Alignment:
| Q |
126 |
ttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
29141211 |
ttaataggtctttatcccctgtaatataggtca |
29141179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 167
Target Start/End: Complemental strand, 31928704 - 31928661
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtt |
167 |
Q |
| |
|
||||||||||| ||||||||| ||||||||| ||||||||||||| |
|
|
| T |
31928704 |
gggttaataggcctttacccc-tgtaatataagtcacttttggtt |
31928661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 38192962 - 38192998
Alignment:
| Q |
123 |
gggttaataggtcttta-ccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
38192962 |
gggttaataggtctttacccccctgtaatataggtca |
38192998 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 170
Target Start/End: Original strand, 47160494 - 47160542
Alignment:
| Q |
123 |
gggttaataggtcttta-ccccctgtaatataggtcacttttggttttg |
170 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||| |||||| |||||| |
|
|
| T |
47160494 |
gggttaatgggtctttagccccctgtaatataggttacttttagttttg |
47160542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 48848198 - 48848142
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||| | ||||||||||| |||||||||||| |||| ||||| |||||||| |
|
|
| T |
48848198 |
tgggttaatggtgctttaccccctataatataggtcattttttgttttcccccctgt |
48848142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 63; Significance: 2e-27; HSPs: 2)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 111 - 314
Target Start/End: Complemental strand, 228657 - 228454
Alignment:
| Q |
111 |
taataattgtttgggttaataggtctttaccccc--tgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnntttattcggtccttgtnn |
208 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||| || | ||||||||||| |
|
|
| T |
228657 |
taataatcttttgggttaataggtctttaccccccgtgtaatataggtcacttttagttttgccccctgtaaaaaaaaaaa-ttgaatcggtccttgtaa |
228559 |
T |
 |
| Q |
209 |
nnnnnttttgttttagaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactga |
308 |
Q |
| |
|
||||||||| ||||| ||||| |||||||||||||||||||||||||||||||| | ||||||||||||| ||||||||||||| |||| |
|
|
| T |
228558 |
tatttttttgttttggaaaacccccc-tagactagctgactgtgcatttttgctgatgtggcatgctccgtcacctttttcggatgacgtggcgcgctga |
228460 |
T |
 |
| Q |
309 |
ctgtat |
314 |
Q |
| |
|
|||||| |
|
|
| T |
228459 |
ctgtat |
228454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 314
Target Start/End: Original strand, 227369 - 227562
Alignment:
| Q |
123 |
gggttaataggtctttacc-ccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnnttt--attcggtccttgtnnnnnnnttttgt |
219 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| | ||| ||||||||||||| |||||| |
|
|
| T |
227369 |
gggttaataggtctttacctccctgtaatataggtcacttttggttttgccccctataatttttattttttttgattcggtccttgtaaaatgtttttgt |
227468 |
T |
 |
| Q |
220 |
tttagaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||| ||||| || || ||||||||||||||||||| |||||||||||| | | ||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
227469 |
tttggaaaacccccc-taaacaagctgactgtgcatttttgttgatgtggcatgctccatcacctttttcggatgacgtggcgcgctgactgtat |
227562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 63; Significance: 2e-27; HSPs: 138)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 22468171 - 22468093
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22468171 |
tagaccagcagactgtgcatttttgctgatgtggcatgctgcgtcaccttttttggatgacgtggcgcactgactgtat |
22468093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 22474392 - 22474314
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22474392 |
tagaccagcagactgtgcatttttgctgatgtggcatgctgcgtcaccttttttggatgacgtggcgcactgactgtat |
22474314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 28462436 - 28462358
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
28462436 |
tagaccagctgactgtgcatttttgctgatgtggcatactgcgtcacctttttcggatgacgtggcgcgctgactgtat |
28462358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 22467096 - 22467174
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || ||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
22467096 |
tagaccagctgactgtgcatttttgctgatgtggcatgctgtgtcaccttttttggatgacgtggcgcgctgactgtat |
22467174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 236 - 313
Target Start/End: Complemental strand, 11830027 - 11829950
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgta |
313 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||| |||| |||||||| |
|
|
| T |
11830027 |
tagaccagttgactgtgcatttttgctgatgtggcatgttgcgtcaccttttttggatgacgtagcgcgttgactgta |
11829950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 123 - 314
Target Start/End: Complemental strand, 15749065 - 15748875
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnntttattcggtccttgtnnnnnnnttttgtttt |
222 |
Q |
| |
|
||||||||||| |||| ||||||||||||| |||||||||||||||||||||||| | ||||||||||||| ||||||||| |
|
|
| T |
15749065 |
gggttaataggcttttatcccctgtaatatatgtcacttttggttttgccccctgtaatttttttttttggattcggtccttgtaaattttttttgtttt |
15748966 |
T |
 |
| Q |
223 |
agaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||| |||| ||||||||||| |||||||||| |||||||| | ||||||||||||||| ||||||||||||| |||||||||| |
|
|
| T |
15748965 |
ggaaaacccccc-tagagcagctgactgtacatttttgctaatgtggcacgctgcgtcacctttttcggatgacgtggcgcgctgactgtat |
15748875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 236 - 312
Target Start/End: Original strand, 28461176 - 28461252
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgt |
312 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||| | |||||||| |
|
|
| T |
28461176 |
tagaccacctgactgtgcatttttgctgatgtggcatgttgtgtcaccttttttggatgacgtggcacgctgactgt |
28461252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 120 - 314
Target Start/End: Complemental strand, 44242415 - 44242222
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgtnnnnnnnnnnnntttattcggtccttgtnnnnnnnttttgt |
219 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||||||||||||||||||| | ||||| ||||||| |||||| |
|
|
| T |
44242415 |
tttgggttaataggcctttacctcctgtaatatagatcacttttggttttgccccctgtaaaaaaaaactttagattcgatccttgtaaattttttttgt |
44242316 |
T |
 |
| Q |
220 |
tttagaaaannnnnnntagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||| ||||| |||||||||||||| ||||||||||||||||||||||| | |||||||||||| ||||||||||| |||||||||| |
|
|
| T |
44242315 |
tttggaaaaccctcc-tagaccagctgactatgcatttttgctgatgtggcatgctccgtcaccttttttggatgacgtggcaggctgactgtat |
44242222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 16670500 - 16670554
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
16670500 |
ggttaataggtctttaccccctgtaatatagggcacttttggttttgccccctgt |
16670554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 38937565 - 38937512
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38937565 |
gggttaataggtctttaccccctgtaatatagggcacttttggttttgccccct |
38937512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 23835829 - 23835774
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
23835829 |
gggttaataggtctttaccccctgtaatatagggcacttttagttttgccccctgt |
23835774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 240 - 314
Target Start/End: Complemental strand, 1873652 - 1873578
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | || |||||| ||||||||||||||||| | |||||||||| |
|
|
| T |
1873652 |
ccagctgactgtgcattttcgctgatgtggcacgctgagtcaccgttttctgatgacgtggcacgctgactgtat |
1873578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 10746336 - 10746410
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| | ||||||||||||||| ||||||||||| | |||||||||| |
|
|
| T |
10746336 |
ccagctgaccgtgcattttcgctgatgtggcacgctgcgtcacctttttcggatgacgtggcacgctgactgtat |
10746410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 236 - 314
Target Start/End: Original strand, 15747863 - 15747941
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||| |||||| |||| |||||||| |||| | |||||||| |
|
|
| T |
15747863 |
tagactagctgactgtgcatttttgctgatgtggcatgttgtgtcaccctttttggatgacgttgcgcgccgactgtat |
15747941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 47; E-Value: 9e-18
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 28141807 - 28141880
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||| ||||||| ||||||||||||| |||| ||||| |
|
|
| T |
28141807 |
ccagctgactgtgcatttttgctgatttggcatgctgcgtca-ctttttcggatgacgtggcgcgctgattgtat |
28141880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 243 - 312
Target Start/End: Complemental strand, 34404528 - 34404459
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgt |
312 |
Q |
| |
|
|||||||||||||||||| |||||||||||| | |||||||||||||| || ||||||||| |||||||| |
|
|
| T |
34404528 |
gctgactgtgcatttttgatgatgtggcatgattcgtcacctttttctaattacgtggcgcgctgactgt |
34404459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 240 - 312
Target Start/End: Complemental strand, 45323834 - 45323761
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacct-ttttctgatgacgtggcgcactgactgt |
312 |
Q |
| |
|
||||||||||||||||||||||||| |||||| | || ||||||| ||||||||||||||||||| |||||||| |
|
|
| T |
45323834 |
ccagctgactgtgcatttttgctgacgtggcacgctgagtcaccttttttctgatgacgtggcgcgctgactgt |
45323761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 1902930 - 1902986
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
1902930 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
1902986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 1904466 - 1904410
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
1904466 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
1904410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 7576325 - 7576381
Alignment:
| Q |
123 |
gggttaataggtcttta-ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7576325 |
gggttaataggtctttatccccctgtaatatagggcacttttggttttgccccctgt |
7576381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 242 - 314
Target Start/End: Complemental strand, 15809314 - 15809242
Alignment:
| Q |
242 |
agctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||| || | || |||||| ||||||||||||||||| |||| ||||||| |
|
|
| T |
15809314 |
agctgactgtgcatttttgctgatgtgacacgctgagtcaccgttttctgatgacgtggcacactaactgtat |
15809242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 22468282 - 22468226
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22468282 |
gggttaataggcctttacccccctgtaatataggtcacttttggttttgccccctgt |
22468226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 22474503 - 22474447
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
22474503 |
gggttaataggcctttacccccctgtaatataggtcacttttggttttgccccctgt |
22474447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 23834581 - 23834637
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
23834581 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
23834637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 22466982 - 22467037
Alignment:
| Q |
124 |
ggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
22466982 |
ggttaataggtctttacccccctgtaatataggtcacttttggttttgtcccctgt |
22467037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 30371385 - 30371440
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
30371385 |
gggttaataggtctttactccctgtaatataggtcatttttggttttcccccctgt |
30371440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 240 - 314
Target Start/End: Complemental strand, 16647807 - 16647733
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||| |||||||||||| | || |||||| |||| |||||||||||||| ||||| |||| |
|
|
| T |
16647807 |
ccagctgactgtgcattttcgctgatgtggcacgctgagtcaccgttttatgatgacgtggcgcgctgaccgtat |
16647733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 240 - 310
Target Start/End: Complemental strand, 18532861 - 18532791
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgact |
310 |
Q |
| |
|
||||||||||||||||||| |||||||||||| || |||||| ||||||||||||||||||| |||||| |
|
|
| T |
18532861 |
ccagctgactgtgcattttcgctgatgtggcacactgagtcaccgttttctgatgacgtggcgcgctgact |
18532791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 240 - 314
Target Start/End: Complemental strand, 20473987 - 20473913
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||| || |||| ||||| ||||||||||||||||| ||||| |||||||||||| ||||||| |||||||||| |
|
|
| T |
20473987 |
ccagccgattgtgtattttcgctgatgtggcatgttgagtcacatttttctgatgatgtggcgctctgactgtat |
20473913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 248 - 314
Target Start/End: Original strand, 38528600 - 38528666
Alignment:
| Q |
248 |
ctgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||| ||| |||||||| |||||||||| |
|
|
| T |
38528600 |
ctgtgcatttttgctgatgtggcatgttgtgtcaccttttttggataacgtggcgtgctgactgtat |
38528666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 120 - 178
Target Start/End: Original strand, 38935942 - 38935999
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||| |
|
|
| T |
38935942 |
tttgggttaataggtctttacccc-tgtaatataggacacttttggttttgcccactgt |
38935999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 121 - 178
Target Start/End: Original strand, 44366865 - 44366923
Alignment:
| Q |
121 |
ttgggttaataggtctttacc-ccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
44366865 |
ttgggttaataggtctttaactccctgtaatatagggcacttttggttttgccccctgt |
44366923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 19686236 - 19686183
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
|||||||||| ||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
19686236 |
gggttaatagtgctttaccccctgtaatatagggcacttttggttttgccccct |
19686183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 7577834 - 7577778
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||| |||||||| |
|
|
| T |
7577834 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttaccccctgt |
7577778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 126 - 178
Target Start/End: Original strand, 28141691 - 28141743
Alignment:
| Q |
126 |
ttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| | |||||| |
|
|
| T |
28141691 |
ttaatagatctttaccccctgtaatataggtcacttttggttttacaccctgt |
28141743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 28462551 - 28462495
Alignment:
| Q |
123 |
gggttaataggtcttta-ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
28462551 |
gggttaataggcctttatccccctgtaatataggtcacttttggttttgcaccctgt |
28462495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 170
Target Start/End: Original strand, 15747751 - 15747798
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttg |
170 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
15747751 |
gggttaatagacctttaccccctgtaatataggtcacttttggttttg |
15747798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 17328092 - 17328147
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||| |||||||| |
|
|
| T |
17328092 |
gggttaataggtctttaccccctgtaatataggtcatttccggttttcccccctgt |
17328147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 22116155 - 22116206
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||| |||| |
|
|
| T |
22116155 |
gggttaataggtctttaccccctgtaatataggtcattttcggttttccccc |
22116206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 34635706 - 34635761
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||| |||||||| |
|
|
| T |
34635706 |
gggttaataggtctttaccccctgtaatataggtcatttccggttttcccccctgt |
34635761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 38815153 - 38815094
Alignment:
| Q |
120 |
tttgggttaataggtctttac-cccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
38815153 |
tttgggttaataggtctttactcccctgtaatataaggcacttttggttttgccctctgt |
38815094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 44241097 - 44241152
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||| ||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
44241097 |
gggttaataggactttactccctgtaatataggtcatttttggttttgtcccctgt |
44241152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 240 - 314
Target Start/End: Original strand, 16647173 - 16647247
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||| ||||| ||| |||||||| | | ||||||||||||||||||||||| || |||||||||| |
|
|
| T |
16647173 |
ccagctgactgtgtattttcgctaatgtggcacgcagagtcacctttttctgatgacgtggagcgctgactgtat |
16647247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 19493505 - 19493459
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
19493505 |
gggttaataggtctttaccccctgtaatataggtcattttcggtttt |
19493459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 244 - 314
Target Start/End: Complemental strand, 28142826 - 28142756
Alignment:
| Q |
244 |
ctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||| |||||||||||||||||||||||| |||||||| |||||| | |||| |||||| | |||||||| |
|
|
| T |
28142826 |
ctgacagtgcatttttgctgatgtggcatgctgcgtcacttttttcggctgacatggcgcccagactgtat |
28142756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 120 - 158
Target Start/End: Original strand, 29835099 - 29835137
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29835099 |
tttgggttaataggtctttaccccctgtaatataggtca |
29835137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 125 - 178
Target Start/End: Complemental strand, 15809430 - 15809377
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||| ||||||| |
|
|
| T |
15809430 |
gttaataggtctttatcccctgcaatataggtcacttttggttttcacccctgt |
15809377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 124 - 169
Target Start/End: Original strand, 18701552 - 18701597
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
18701552 |
ggttaataggtctttatcccctgtaatataggtcatttttggtttt |
18701597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 120 - 169
Target Start/End: Original strand, 33641129 - 33641178
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||| |||||| |
|
|
| T |
33641129 |
tttgggttaataggtctttaccctctgtaatataggtcattttcggtttt |
33641178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 122 - 174
Target Start/End: Original strand, 12028197 - 12028249
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||| |||| |||| |
|
|
| T |
12028197 |
tgggttaataggtctttacaccctgtaatataggtcatttttgatttttcccc |
12028249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 18250947 - 18250891
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| || ||||||||||||| ||||| |
|
|
| T |
18250947 |
gggttaataggtctttacccccctgtaatatagggcatttttggttttgcctcctgt |
18250891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 122 - 158
Target Start/End: Original strand, 19641445 - 19641481
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19641445 |
tgggttaataggtctttaccccctgtaatataggtca |
19641481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 122 - 158
Target Start/End: Original strand, 19840038 - 19840074
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19840038 |
tgggttaataggtctttaccccctgtaatataggtca |
19840074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 25227823 - 25227879
Alignment:
| Q |
123 |
gggttaataggtctttaccc-cctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| || ||||||| |||||||| |
|
|
| T |
25227823 |
gggttaataggtctttaccctcctgtaatataggtcatttctggttttcccccctgt |
25227879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 126 - 178
Target Start/End: Complemental strand, 28484646 - 28484594
Alignment:
| Q |
126 |
ttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |||||||||| | |||||| |
|
|
| T |
28484646 |
ttaataggtctttactccctgtaatataggtcatttttggttttccgccctgt |
28484594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 49 - 101
Target Start/End: Original strand, 29894375 - 29894427
Alignment:
| Q |
49 |
tgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaa |
101 |
Q |
| |
|
||||||||| |||| | |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29894375 |
tgagcgaccccattggcttgcctcctattgaactcgacatgagagttctgaaa |
29894427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 125 - 169
Target Start/End: Complemental strand, 30371651 - 30371607
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| || ||||||| |
|
|
| T |
30371651 |
gttaataggtctttaccccctgtaatataggtcatttctggtttt |
30371607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 49 - 101
Target Start/End: Complemental strand, 36365097 - 36365045
Alignment:
| Q |
49 |
tgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaa |
101 |
Q |
| |
|
|||||||||||||| | |||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
36365097 |
tgagcgacctcattggcttgcctcctattgaactcgacatgggagttctgaaa |
36365045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 3364618 - 3364567
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| ||| |||||| |||| |
|
|
| T |
3364618 |
gggttaataggtctttaccccctgtaatataagtcattttcggtttttcccc |
3364567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 28461068 - 28461122
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
28461068 |
gggttaataagcctttaccccctgtaatataggtc-cttttggttttggcccctgt |
28461122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 9 - 112
Target Start/End: Original strand, 28589966 - 28590069
Alignment:
| Q |
9 |
atggggactatgattagatagggttgtctaaactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatctatta |
108 |
Q |
| |
|
|||||| ||| |||||||||||| || || | |||| | |||||| ||| ||| | |||||||| |||||||||||||||||||||||||||||| | |
|
|
| T |
28589966 |
atgggggctaggattagatagggctgcctgagctaactcgtgagctaccctatttgcttgcctccggctgaactcaacatgagagttctgaaatctatca |
28590065 |
T |
 |
| Q |
109 |
acta |
112 |
Q |
| |
|
|||| |
|
|
| T |
28590066 |
acta |
28590069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 37147551 - 37147586
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
37147551 |
gggttaataggtctttaccccctgtaatataggtca |
37147586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 38528505 - 38528560
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| ||||||| |||| |||||| ||||||||||||||||||||||| |
|
|
| T |
38528505 |
gggttaataggcctttacctcctgcaatatatatcacttttggttttgccccctgt |
38528560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 239 - 314
Target Start/End: Original strand, 44241213 - 44241287
Alignment:
| Q |
239 |
accagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| | |||| ||||||| |||||||||||| |||||||||| |
|
|
| T |
44241213 |
accagctgactgtgtatttt-gctgatgtggcatgctccgtctccttttttggatgacgtggcgggctgactgtat |
44241287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 19052230 - 19052184
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| || ||||||| |
|
|
| T |
19052230 |
gggttaataggtctttaccccctgtaatatatgtcatttctggtttt |
19052184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 120 - 158
Target Start/End: Complemental strand, 20182554 - 20182516
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
20182554 |
tttgggttaataggtctttaccccccgtaatataggtca |
20182516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 22535454 - 22535500
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| ||| |||||| |
|
|
| T |
22535454 |
gggttaataggtctttaccccctttaatataggtcattttcggtttt |
22535500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 124 - 174
Target Start/End: Complemental strand, 22535739 - 22535689
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||| || ||||||| |||| |
|
|
| T |
22535739 |
ggttaataggtctttacctcctgtaatataggtcatttctggttttccccc |
22535689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 177
Target Start/End: Complemental strand, 25927178 - 25927124
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctg |
177 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| || ||||||| ||||||| |
|
|
| T |
25927178 |
gggttaataggtctttatcccttgtaatataggtcatttctggtttttccccctg |
25927124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 120 - 174
Target Start/End: Original strand, 29640760 - 29640814
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
29640760 |
tttgggttaatggtgctttaccccctgtaatataggtcatttttggttttccccc |
29640814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 124 - 178
Target Start/End: Complemental strand, 34404646 - 34404592
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||||||| ||| |||| |
|
|
| T |
34404646 |
ggttaataggcttttaccccctgtaatatatgtcacttttggttttcccctctgt |
34404592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 38210865 - 38210919
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | || ||||||| ||||||| |
|
|
| T |
38210865 |
ggttaataggtctttaccccctgtaatataggtaatttctggttttctcccctgt |
38210919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 124 - 158
Target Start/End: Original strand, 38385936 - 38385970
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
38385936 |
ggttaataggtctttaccccctgtaatataggtca |
38385970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 38877078 - 38877032
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||| ||||||||||||||||||| | ||||||||||||| |
|
|
| T |
38877078 |
gggttaatagggctttaccccctgtaatataaggcacttttggtttt |
38877032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 120 - 158
Target Start/End: Original strand, 43301877 - 43301915
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
43301877 |
tttgagttaataggtctttaccccctgtaatataggtca |
43301915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 241 - 314
Target Start/End: Original strand, 15481607 - 15481680
Alignment:
| Q |
241 |
cagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||| |||||||||||| |||||||||||| | || |||||| |||| ||||||| |||| | |||||||||| |
|
|
| T |
15481607 |
cagctaactgtgcattttcgctgatgtggcacgctgagtcaccgttttttgatgacatggcccgctgactgtat |
15481680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 123 - 156
Target Start/End: Complemental strand, 16577404 - 16577371
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggt |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
16577404 |
gggttaataggtctttaccccctgtaatataggt |
16577371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 126 - 178
Target Start/End: Original strand, 38875991 - 38876044
Alignment:
| Q |
126 |
ttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||| ||||||||| |||||||||||| ||||||||||||| |||||||| |
|
|
| T |
38875991 |
ttaatagggctttacccccctgtaatataggacacttttggtttttccccctgt |
38876044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 85439 - 85491
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||| |||||| |||| |
|
|
| T |
85439 |
gggttaataggtctttacccccttgtaatataggtcattttcggtttttcccc |
85491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 5969724 - 5969780
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| ||||| ||||||||||||||| ||||||||||||||| ||||| |
|
|
| T |
5969724 |
tgggttaatagagctttatcccctgtaatatagggtacttttggttttgcctcctgt |
5969780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 170
Target Start/End: Original strand, 18249631 - 18249679
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttg |
170 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| | |||||||||||||| |
|
|
| T |
18249631 |
gggttaataggtctttacccccttgtaatatatggcacttttggttttg |
18249679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 21903923 - 21903979
Alignment:
| Q |
123 |
gggttaataggtctttac-cccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||| || |||||| ||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
21903923 |
gggttaatggggctttacacccctgtaatatagggcacttttggttttcccccctgt |
21903979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 163
Target Start/End: Original strand, 23260320 - 23260360
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcactttt |
163 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
23260320 |
gggttaataggtctttactccctgtaatataggtcattttt |
23260360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 49 - 101
Target Start/End: Complemental strand, 24543270 - 24543218
Alignment:
| Q |
49 |
tgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaa |
101 |
Q |
| |
|
||||||||| |||| | |||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
24543270 |
tgagcgaccccattggcttgcatcctattgaactcgacatgagagttctgaaa |
24543218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 122 - 169
Target Start/End: Original strand, 28149432 - 28149480
Alignment:
| Q |
122 |
tgggttaataggtctttacccc-ctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| || ||||||| |
|
|
| T |
28149432 |
tgggttaataggtctttacccctctgtaatataggtcatttctggtttt |
28149480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 122 - 158
Target Start/End: Complemental strand, 28149724 - 28149688
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
28149724 |
tgggttaataggtttttaccccctgtaatataggtca |
28149688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 121 - 169
Target Start/End: Original strand, 37200345 - 37200392
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||| |||||| |
|
|
| T |
37200345 |
ttgggttaataggtcttta-cccctgtaatataggtcattttcggtttt |
37200392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 758802 - 758747
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| || |||||| |||||||| |
|
|
| T |
758802 |
gggttaatagtgctttaccccctgtaatataggtcatttccggttttcccccctgt |
758747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 170
Target Start/End: Complemental strand, 5970810 - 5970764
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttg |
170 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
5970810 |
gggttaataggtctttacccc-tgtaatatagggtacttttggttttg |
5970764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 8237989 - 8238044
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| |||||||| |||||||||| |||||||||||||||||||||| |
|
|
| T |
8237989 |
gggttaatagtgttttaccccatgtaatatagaacacttttggttttgccccctgt |
8238044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 174
Target Start/End: Complemental strand, 14793500 - 14793461
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
14793500 |
ctttaccccctgtaatataggtcatttttggttttccccc |
14793461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 15481489 - 15481536
Alignment:
| Q |
123 |
gggttaataggtcttta-ccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||| ||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
15481489 |
gggttaataggcctttatccccctgcaatataggtcacttttggtttt |
15481536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 174
Target Start/End: Complemental strand, 17328382 - 17328331
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||||||||||| |||| |||| || ||||||| |||| |
|
|
| T |
17328382 |
gggttaataggtctttaccccctgtattatatgtcatttctggttttccccc |
17328331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 178
Target Start/End: Original strand, 19684215 - 19684258
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||| ||||||| |
|
|
| T |
19684215 |
ctttaccccctgtaatatatgacacttttggttttgtcccctgt |
19684258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 174
Target Start/End: Complemental strand, 24952100 - 24952061
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
24952100 |
ctttaccccctgtaatataggtcatttttggttttccccc |
24952061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 178
Target Start/End: Complemental strand, 32845707 - 32845664
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||| |||||||| |
|
|
| T |
32845707 |
ctttaccccctgtaatataggtcattttttgttttcccccctgt |
32845664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 239 - 314
Target Start/End: Original strand, 33868590 - 33868664
Alignment:
| Q |
239 |
accagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||| ||| ||||| |||||||||||| | || |||||| |||| ||||||||||| || |||||||||| |
|
|
| T |
33868590 |
accagctgacagtgtattttcgctgatgtggcacgctgagtcacc-ttttatgatgacgtggtgcgctgactgtat |
33868664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 39150226 - 39150277
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||| | ||||||||||||||||||| | |||||||||||||||| |
|
|
| T |
39150226 |
gggttaatagtgcattaccccctgtaatataggactcttttggttttgcccc |
39150277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 41305881 - 41305935
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| | ||||||||| ||||| |||| |
|
|
| T |
41305881 |
gggttaataggtctttacccc-tgtaatatagggcgcttttggttctgccctctgt |
41305935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 77 - 112
Target Start/End: Original strand, 41315947 - 41315982
Alignment:
| Q |
77 |
tgaactcaacatgagagttctgaaatctattaacta |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||| |
|
|
| T |
41315947 |
tgaactcaacatgagagttctgaaatctatcaacta |
41315982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 3364327 - 3364373
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||| ||||||||||||| |||| ||| |||||| |
|
|
| T |
3364327 |
gggttaataggtctttatcccctgtaatataagtcattttcggtttt |
3364373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 65 - 107
Target Start/End: Complemental strand, 6860543 - 6860501
Alignment:
| Q |
65 |
tttgcctcctattgaactcaacatgagagttctgaaatctatt |
107 |
Q |
| |
|
|||||||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
6860543 |
tttgcctcctgttgaactcgacatgagagttttgaaatctatt |
6860501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 135 - 169
Target Start/End: Complemental strand, 8214604 - 8214570
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
8214604 |
ctttaccccctgtaatataggtcatttttggtttt |
8214570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 124 - 174
Target Start/End: Original strand, 17688020 - 17688070
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||| |||| ||||| |||| |
|
|
| T |
17688020 |
ggttaatcgttctttaccccctgtaatataggtcattttttgttttccccc |
17688070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 120 - 178
Target Start/End: Complemental strand, 22293603 - 22293545
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||| | ||| ||||||||||||| | ||||||| ||||| |||||||| |
|
|
| T |
22293603 |
tttgggttaataggccgttaacccctgtaatataaggcactttttgtttttccccctgt |
22293545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 136 - 178
Target Start/End: Original strand, 23045180 - 23045222
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||| |||||||||||||||| |||||||||| |||||||| |
|
|
| T |
23045180 |
tttacctcctgtaatataggtcatttttggttttcccccctgt |
23045222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 140 - 178
Target Start/End: Original strand, 31108364 - 31108402
Alignment:
| Q |
140 |
ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
31108364 |
ccccctgtaatataggtcatttttggttttcccccctgt |
31108402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 136 - 178
Target Start/End: Complemental strand, 31108627 - 31108585
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||| |||| ||||| |||||||| |
|
|
| T |
31108627 |
tttaccccctgtaatataggtcattttttgttttcccccctgt |
31108585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 140 - 178
Target Start/End: Original strand, 34831509 - 34831547
Alignment:
| Q |
140 |
ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
34831509 |
ccccctgtaatatatgtcatttttggttttgccccctgt |
34831547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 124 - 169
Target Start/End: Complemental strand, 37147842 - 37147796
Alignment:
| Q |
124 |
ggttaataggtctttacccc-ctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| || ||||||| |
|
|
| T |
37147842 |
ggttaataggtctttaccccactgtaatataggtcatttctggtttt |
37147796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 38386216 - 38386170
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||| ||||||| |||||||||||||||| | |||||||||| |
|
|
| T |
38386216 |
gggttaatatgtctttatcccctgtaatataggttatttttggtttt |
38386170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 136 - 178
Target Start/End: Original strand, 39341279 - 39341321
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
39341279 |
tttaccccctgtaatataggtcatttttggttttctcccctgt |
39341321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 135 - 169
Target Start/End: Complemental strand, 43766526 - 43766492
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |
|
|
| T |
43766526 |
ctttaccccctgtaatataggtcatttttggtttt |
43766492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 244 - 314
Target Start/End: Original strand, 44578165 - 44578235
Alignment:
| Q |
244 |
ctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||||||||| ||||| ||||| | |||| ||||| |
|
|
| T |
44578165 |
ctgactgtacatttttgctgatgtggcacactgcgtcaccttttttggatgatgtggcacgctgattgtat |
44578235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 45464668 - 45464622
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||| ||| |||||| |
|
|
| T |
45464668 |
gggttaataggtttttacctcctgtaatataggtcattttcggtttt |
45464622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 66 - 107
Target Start/End: Complemental strand, 10977797 - 10977756
Alignment:
| Q |
66 |
ttgcctcctattgaactcaacatgagagttctgaaatctatt |
107 |
Q |
| |
|
||||||| | ||||||||||||||||||||||| |||||||| |
|
|
| T |
10977797 |
ttgcctcatgttgaactcaacatgagagttctggaatctatt |
10977756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 126 - 174
Target Start/End: Original strand, 15808728 - 15808777
Alignment:
| Q |
126 |
ttaataggtcttta-ccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||| |||||| |||||||||||||||||||||| |||| |
|
|
| T |
15808728 |
ttaataggtctttatccccctacaatataggtcacttttggttttccccc |
15808777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 18048817 - 18048869
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
|||||||||| ||||||||| |||||||||||||| |||||||||| |||||| |
|
|
| T |
18048817 |
gggttaatagtgctttacccc-tgtaatataggtcatttttggttttaccccct |
18048869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 169
Target Start/End: Complemental strand, 29098303 - 29098261
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||| |
|
|
| T |
29098303 |
gttaataggtctttaccc--tgtaatataggtcatttttggtttt |
29098261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 158
Target Start/End: Original strand, 32449689 - 32449722
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |
|
|
| T |
32449689 |
gttaataggtctttaccccctttaatataggtca |
32449722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 123 - 163
Target Start/End: Original strand, 33868475 - 33868516
Alignment:
| Q |
123 |
gggttaataggtctttaccc-cctgtaatataggtcactttt |
163 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
33868475 |
gggttaataggtctttatcctcctgtaatataggtcactttt |
33868516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 124 - 153
Target Start/End: Original strand, 34428638 - 34428667
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatata |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34428638 |
ggttaataggtctttaccccctgtaatata |
34428667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 136 - 169
Target Start/End: Complemental strand, 39341399 - 39341366
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
39341399 |
tttaccccctgtaatataggtcatttttggtttt |
39341366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 178
Target Start/End: Complemental strand, 43015240 - 43015203
Alignment:
| Q |
141 |
cccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
43015240 |
cccctgtaatataggtcatttttggttttgtcccctgt |
43015203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 43302173 - 43302124
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||| ||| |||||||||||| | ||| |||||| |
|
|
| T |
43302173 |
tttgggttaataggtctttatcccatgtaatataggttattttcggtttt |
43302124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 121 - 174
Target Start/End: Original strand, 44610925 - 44610978
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||| | |||||||||| |||| |
|
|
| T |
44610925 |
ttgggttaatggtgctttaccccctgtaatataggttatttttggtttttcccc |
44610978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 178
Target Start/End: Complemental strand, 45161420 - 45161383
Alignment:
| Q |
141 |
cccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
45161420 |
cccctgtaatatagggcacttttggttttgcctcctgt |
45161383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 136 - 168
Target Start/End: Original strand, 5558235 - 5558267
Alignment:
| Q |
136 |
tttaccccctgtaatataggtcacttttggttt |
168 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
5558235 |
tttaccccctgtaatataggtcatttttggttt |
5558267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 9468578 - 9468522
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| ||||| |||| |||||||||||| ||| ||||||||||||||| |
|
|
| T |
9468578 |
tgggttaatagtgttttacaccctataatataggtcattttcggttttgccccctgt |
9468522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 250 - 290
Target Start/End: Complemental strand, 13379454 - 13379414
Alignment:
| Q |
250 |
gtgcatttttgctgatgtggcatgttgcgtcacctttttct |
290 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
13379454 |
gtgcatttttggtgatgtggcatgttatgtcacctttttct |
13379414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 18701844 - 18701808
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18701844 |
gggttaataggtctttacccccttgtaatataggtca |
18701808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 129 - 169
Target Start/End: Complemental strand, 20474095 - 20474055
Alignment:
| Q |
129 |
ataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||| |||||||||||| |||||||||| ||||||||||| |
|
|
| T |
20474095 |
ataggcctttaccccctgcaatataggtctcttttggtttt |
20474055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 47 - 95
Target Start/End: Complemental strand, 27072419 - 27072371
Alignment:
| Q |
47 |
tgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagtt |
95 |
Q |
| |
|
||||||| |||||||| | |||||||||| | ||||||||||||||||| |
|
|
| T |
27072419 |
tgtgagcaacctcatttgcttgcctcctaataaactcaacatgagagtt |
27072371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 126 - 178
Target Start/End: Complemental strand, 28142951 - 28142900
Alignment:
| Q |
126 |
ttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||| |||||||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
28142951 |
ttaataggcatttaccccct-taatatatgtcacttttggttttgccctctgt |
28142900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 126 - 174
Target Start/End: Original strand, 29098022 - 29098070
Alignment:
| Q |
126 |
ttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||| || ||||||| |||| |
|
|
| T |
29098022 |
ttaataggtctttaccccttgtaatataagtcatttctggttttccccc |
29098070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 122 - 174
Target Start/End: Complemental strand, 29835354 - 29835302
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||| || ||||||| |||| |
|
|
| T |
29835354 |
tgggttaataggtctttaccctctgtaatatgtgtcatttctggttttccccc |
29835302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 244 - 308
Target Start/End: Complemental strand, 34067947 - 34067884
Alignment:
| Q |
244 |
ctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactga |
308 |
Q |
| |
|
||||||||||||| | ||||||||||| | || |||||||||||||||||| ||||||| |||| |
|
|
| T |
34067947 |
ctgactgtgcattata-ctgatgtggcacgctgagtcacctttttctgatgatgtggcgcgctga |
34067884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Complemental strand, 34636000 - 34635964
Alignment:
| Q |
123 |
gggttaataggtctttac-cccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||| |
|
|
| T |
34636000 |
gggttaataggtctttacccccctgtaatataggtca |
34635964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 59; Significance: 6e-25; HSPs: 2)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 59; E-Value: 6e-25
Query Start/End: Original strand, 236 - 314
Target Start/End: Complemental strand, 111488 - 111410
Alignment:
| Q |
236 |
tagaccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| ||||||||||||||| ||||||||||||| |||| ||||| |
|
|
| T |
111488 |
tagaccagctgactatgcatttttgctgatgtggcatgatgcgtcacctttttcagatgacgtggcgcgctgattgtat |
111410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 110409 - 110465
Alignment:
| Q |
123 |
gggttaataggtcttta-ccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||| |||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
110409 |
gggttaataggcatttatccccctgtaatatatgtcacttttggttttgctccctgt |
110465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 58; Significance: 2e-24; HSPs: 2)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 245 - 314
Target Start/End: Original strand, 4687 - 4756
Alignment:
| Q |
245 |
tgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
4687 |
tgactgtgcatttttgctgatgtggcatgatgcgtcatctttttctgatgacgtggcgcgctgactgtat |
4756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250; HSP #2
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 10080 - 10135
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
10080 |
gggttaataggtctttaccccctgtaatatagggcacttttagttttgccccctgt |
10135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0095 (Bit Score: 52; Significance: 9e-21; HSPs: 3)
Name: scaffold0095
Description:
Target: scaffold0095; HSP #1
Raw Score: 52; E-Value: 9e-21
Query Start/End: Original strand, 243 - 314
Target Start/End: Original strand, 10474 - 10545
Alignment:
| Q |
243 |
gctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||||||||| |||||||||| |||||||||||||||| | |||||||||| |||||||||| |
|
|
| T |
10474 |
gctgactgtgcatttttgcttatgtggcatgatgcgtcacctttttctaacgacgtggcgcgctgactgtat |
10545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0095; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 247 - 314
Target Start/End: Complemental strand, 11132 - 11065
Alignment:
| Q |
247 |
actgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||||||||||||| |||||||||||| || || || ||||| |||||||||||||| |||| ||||| |
|
|
| T |
11132 |
actgtgcatttttggtgatgtggcatgatgtgttacatttttgtgatgacgtggcgcgctgaatgtat |
11065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0095; HSP #3
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 10355 - 10410
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||| |||||||||| ||||||| |||| |||||||||| | |||||| |
|
|
| T |
10355 |
gggttaataggtttttaccccctctaatataagtcatttttggttttcctccctgt |
10410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0136 (Bit Score: 48; Significance: 2e-18; HSPs: 4)
Name: scaffold0136
Description:
Target: scaffold0136; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 35599 - 35654
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
35599 |
gggttaataggtctttaccccctaaaatataggtcacttttggttttgccccctgt |
35654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0136; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 693 - 638
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| || ||||||| |||||||| |
|
|
| T |
693 |
gggttaataggtctttaccctctgtaatataggtcatttatggttttcccccctgt |
638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0136; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 240 - 314
Target Start/End: Complemental strand, 36683 - 36609
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgtat |
314 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||| || || ||||||||| |||| | ||||| |||||||||| |
|
|
| T |
36683 |
ccagttgactgtacatttttgctgatgtggcatgctgtgtaacctttttcgaatgatgaggcgcgctgactgtat |
36609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0136; HSP #4
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 125 - 169
Target Start/End: Complemental strand, 36798 - 36754
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||| |||||||||| |
|
|
| T |
36798 |
gttaataggcctttaccccctataatataggtcatttttggtttt |
36754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 45; Significance: 1e-16; HSPs: 1)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 345 - 289
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
345 |
gggttaataggtctttacccccatgtaatatagggcacttttggttttgccccctgt |
289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0040 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 2)
Name: scaffold0040
Description:
Target: scaffold0040; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 122 - 178
Target Start/End: Original strand, 64502 - 64559
Alignment:
| Q |
122 |
tgggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
64502 |
tgggttaataggtctttacccccctgtaatatagggtacttttggttttgccccctgt |
64559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0040; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 66101 - 66045
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| | |||||||||||||||||||||| |
|
|
| T |
66101 |
gggttaataggtctttacccccctgtaatatatgacacttttggttttgccccctgt |
66045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 2)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 121 - 174
Target Start/End: Original strand, 26306 - 26359
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||||| |||| |
|
|
| T |
26306 |
ttgggttaataggtctttaccccctgtaatataggtcattttcggttttccccc |
26359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 5 - 112
Target Start/End: Original strand, 255376 - 255483
Alignment:
| Q |
5 |
tcatatggggactatgattagatagggttgtctaaactaatttgtgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctgaaatct |
104 |
Q |
| |
|
|||||||||| ||| |||||||||||| || || | |||| |||||| ||| ||| | |||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
255376 |
tcatatgggggctaggattagatagggctgcctgagctaacccgtgagctaccctatttgcttgcctccggctgaactcaacatgagaattctgaaatct |
255475 |
T |
 |
| Q |
105 |
attaacta |
112 |
Q |
| |
|
|| ||||| |
|
|
| T |
255476 |
atcaacta |
255483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0804 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: scaffold0804
Description:
Target: scaffold0804; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 2733 - 2789
Alignment:
| Q |
123 |
gggttaataggtctttac-cccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||||||||||| ||||| |
|
|
| T |
2733 |
gggttaataggtctttactcccctgtaatatagggcacttttggttttgcctcctgt |
2789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0384 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: scaffold0384
Description:
Target: scaffold0384; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 120 - 168
Target Start/End: Complemental strand, 4487 - 4439
Alignment:
| Q |
120 |
tttgggttaataggtctttaccccctgtaatataggtcacttttggttt |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
4487 |
tttgggttaataggtctttaccccctgtaatataggtcattttcggttt |
4439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0384; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 4249 - 4300
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| || ||||||| |||| |
|
|
| T |
4249 |
gggttaataggtctttactccctgtaatataggtcatttatggttttccccc |
4300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0228 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 3)
Name: scaffold0228
Description:
Target: scaffold0228; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 8082 - 8134
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
8082 |
gggttaataggtctttacccccctgtaatataggacacttttggttttgcccc |
8134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0228; HSP #2
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 15664 - 15716
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
15664 |
gggttaataggtctttacccccctgtaatataggacacttttggttttgcccc |
15716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0228; HSP #3
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 25616 - 25668
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
25616 |
gggttaataggtctttacccccctgtaatataggacacttttggttttgcccc |
25668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 4707 - 4763
Alignment:
| Q |
123 |
gggttaataggtctttacccc-ctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| |||||||||||||||| ||||| |
|
|
| T |
4707 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttgcctcctgt |
4763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 122 - 174
Target Start/End: Complemental strand, 5954 - 5901
Alignment:
| Q |
122 |
tgggttaataggtctttaccc-cctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||| |||||||||||||||||| |
|
|
| T |
5954 |
tgggttaataggtctttacactcctgtaatatagggcacttttggttttgcccc |
5901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0769 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: scaffold0769
Description:
Target: scaffold0769; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 4208 - 4153
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| || |||||| |||||||| |
|
|
| T |
4208 |
gggttaataggtctttaccccctgtaatataggtcatttccggttttcccccctgt |
4153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0769; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 3914 - 3950
Alignment:
| Q |
123 |
gggttaataggtcttta-ccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
3914 |
gggttaataggtctttacccccctgtaatataggtca |
3950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0142 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0142
Description:
Target: scaffold0142; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 121 - 158
Target Start/End: Complemental strand, 34885 - 34848
Alignment:
| Q |
121 |
ttgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34885 |
ttgggttaataggtctttaccccctgtaatataggtca |
34848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0098 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: scaffold0098
Description:
Target: scaffold0098; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 240 - 312
Target Start/End: Complemental strand, 42883 - 42811
Alignment:
| Q |
240 |
ccagctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggcgcactgactgt |
312 |
Q |
| |
|
||||| ||||||||||||||| ||||||| |||| || |||| ||||||||| ||||||||| | |||||||| |
|
|
| T |
42883 |
ccagccgactgtgcatttttgttgatgtgacatgctgggtcagctttttctgctgacgtggcacgctgactgt |
42811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0098; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 124 - 174
Target Start/End: Complemental strand, 42998 - 42948
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||||| ||||| |||| |
|
|
| T |
42998 |
ggttaataagtctttaccccctgtaatataaatcacttttagttttccccc |
42948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 37; Significance: 0.000000000008; HSPs: 2)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 122 - 158
Target Start/End: Original strand, 1826 - 1862
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1826 |
tgggttaataggtctttaccccctgtaatataggtca |
1862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 178
Target Start/End: Complemental strand, 2117 - 2061
Alignment:
| Q |
123 |
gggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| || ||||||| ||||||| |
|
|
| T |
2117 |
gggttaataggtctttacccccctgtaatataggtcatttctggttttcacccctgt |
2061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0450 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0450
Description:
Target: scaffold0450; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 7859 - 7910
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||| || ||||||| |||| |
|
|
| T |
7859 |
gggttaataggtctttaccccctgtaatatatgtcatttctggttttccccc |
7910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0450; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 8152 - 8106
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| || ||||||| |
|
|
| T |
8152 |
gggttaataggtctttacccactgtaatataggtcatttctggtttt |
8106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0246 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0246
Description:
Target: scaffold0246; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 178
Target Start/End: Original strand, 15872 - 15927
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||| ||||||||||||| | ||||||| |||||| ||||||| |
|
|
| T |
15872 |
gggttaataggtctttatcccctgtaatatatgacactttttgttttgtcccctgt |
15927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0227
Description:
Target: scaffold0227; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 23685 - 23740
Alignment:
| Q |
124 |
ggttaataggtctttaccccc-tgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||||||||||||| ||||||||| | |||||||| ||||||||||||| |
|
|
| T |
23685 |
ggttaataggtctttacccccatgtaatataagacacttttgattttgccccctgt |
23740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 117 - 176
Target Start/End: Complemental strand, 25001 - 24941
Alignment:
| Q |
117 |
ttgtttgggttaataggtctttaccccct-gtaatataggtcacttttggttttgccccct |
176 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||| ||||||| ||||||||||| |
|
|
| T |
25001 |
ttgtttgggttaatagagctttacccccttgtaatatagggtacttttgattttgccccct |
24941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 123 - 158
Target Start/End: Original strand, 91050 - 91085
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
91050 |
gggttaataggtctttaccccctgtaatataggtca |
91085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 135 - 178
Target Start/End: Complemental strand, 53567 - 53524
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
53567 |
ctttaccccctgtaatataggtcatttttggttttcccccctgt |
53524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0727 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0727
Description:
Target: scaffold0727; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 123 - 177
Target Start/End: Complemental strand, 1199 - 1145
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctg |
177 |
Q |
| |
|
||||||||||||||||| ||| |||||||||||||| || ||||||| ||||||| |
|
|
| T |
1199 |
gggttaataggtctttatcccttgtaatataggtcatttctggtttttccccctg |
1145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 34; Significance: 0.0000000005; HSPs: 3)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 34; E-Value: 0.0000000005
Query Start/End: Original strand, 244 - 301
Target Start/End: Complemental strand, 16006 - 15949
Alignment:
| Q |
244 |
ctgactgtgcatttttgctgatgtggcatgttgcgtcacctttttctgatgacgtggc |
301 |
Q |
| |
|
||||||||||||||| |||||||||||| | || |||||| ||||||||||| ||||| |
|
|
| T |
16006 |
ctgactgtgcattttcgctgatgtggcacgctgagtcaccattttctgatgatgtggc |
15949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 124 - 178
Target Start/End: Original strand, 14830 - 14885
Alignment:
| Q |
124 |
ggttaataggtctttaccccct-gtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||| |||||||| || | |||||||||||||||||||||| |||||||| |
|
|
| T |
14830 |
ggttaataggcctttaccctcttgcaatataggtcacttttggttttcccccctgt |
14885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007; HSP #3
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 55 - 95
Target Start/End: Original strand, 234731 - 234771
Alignment:
| Q |
55 |
acctcattcgtttgcctcctattgaactcaacatgagagtt |
95 |
Q |
| |
|
||||||||||||||||||||| | ||||| ||||||||||| |
|
|
| T |
234731 |
acctcattcgtttgcctcctaataaactcgacatgagagtt |
234771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0079 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0079
Description:
Target: scaffold0079; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 123 - 174
Target Start/End: Original strand, 6810 - 6862
Alignment:
| Q |
123 |
gggttaataggtcttta-ccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| || ||||||| |||| |
|
|
| T |
6810 |
gggttaataggtctttatccccctgtaatataggtcatttatggttttccccc |
6862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0809 (Bit Score: 32; Significance: 0.000000008; HSPs: 2)
Name: scaffold0809
Description:
Target: scaffold0809; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 124 - 163
Target Start/End: Complemental strand, 4053 - 4014
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcactttt |
163 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
4053 |
ggttaataggtctttaccccctgtaatatagatcattttt |
4014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0809; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 124 - 168
Target Start/End: Original strand, 3770 - 3813
Alignment:
| Q |
124 |
ggttaataggtctttaccccctgtaatataggtcacttttggttt |
168 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||| || |||||| |
|
|
| T |
3770 |
ggttaataggtcttta-cccctgtaatataggtcatttctggttt |
3813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0192 (Bit Score: 32; Significance: 0.000000008; HSPs: 1)
Name: scaffold0192
Description:
Target: scaffold0192; HSP #1
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 135 - 178
Target Start/End: Complemental strand, 14492 - 14449
Alignment:
| Q |
135 |
ctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |||| |||||||| |
|
|
| T |
14492 |
ctttaccccctgtaatataggtcatttttgattttcccccctgt |
14449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 31; Significance: 0.00000003; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 123 - 169
Target Start/End: Original strand, 432395 - 432441
Alignment:
| Q |
123 |
gggttaataggtctttaccccctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||| ||| |||||| |
|
|
| T |
432395 |
gggttaatagtactttaccccctgtaatataggtcattttcggtttt |
432441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 122 - 178
Target Start/End: Complemental strand, 332441 - 332385
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||| || |||||| |||||||| |
|
|
| T |
332441 |
tgggttaatagtgctttacccccagtaatataggtcatttccggttttcccccctgt |
332385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1554 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold1554
Description:
Target: scaffold1554; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 125 - 158
Target Start/End: Complemental strand, 388 - 355
Alignment:
| Q |
125 |
gttaataggtctttaccccctgtaatataggtca |
158 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
388 |
gttaataggtctttaccccatgtaatataggtca |
355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 49 - 98
Target Start/End: Complemental strand, 48159 - 48110
Alignment:
| Q |
49 |
tgagcgacctcattcgtttgcctcctattgaactcaacatgagagttctg |
98 |
Q |
| |
|
||||||||| ||| |||||||||||||| ||||| |||||||||||||| |
|
|
| T |
48159 |
tgagcgaccatattagtttgcctcctattcaactcgacatgagagttctg |
48110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 141 - 178
Target Start/End: Complemental strand, 150264 - 150227
Alignment:
| Q |
141 |
cccctgtaatataggtcacttttggttttgccccctgt |
178 |
Q |
| |
|
|||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
150264 |
cccctgtaatataggtcatttttggttttcccccctgt |
150227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0933 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0933
Description:
Target: scaffold0933; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 122 - 174
Target Start/End: Complemental strand, 2776 - 2724
Alignment:
| Q |
122 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
174 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
2776 |
tgggttaatagagttttaccccctgtaatatagggtacttttggatttgcccc |
2724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0632 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0632
Description:
Target: scaffold0632; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 126 - 169
Target Start/End: Original strand, 2771 - 2815
Alignment:
| Q |
126 |
ttaataggtctttaccc-cctgtaatataggtcacttttggtttt |
169 |
Q |
| |
|
||||||||||||||| | |||||||||||||||| |||||||||| |
|
|
| T |
2771 |
ttaataggtctttacactcctgtaatataggtcatttttggtttt |
2815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University