View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2168_low_14 (Length: 279)
Name: NF2168_low_14
Description: NF2168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2168_low_14 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 16 - 272
Target Start/End: Complemental strand, 11832153 - 11831896
Alignment:
| Q |
16 |
attcatgaaagtaaaatcctctcaaatagaattatttgatactcatttaatgcactgtatggcaaatacttggaccgtcttcaatcttcttatctaaaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||| |
|
|
| T |
11832153 |
attcatgaaagtaaaatcctctcaaatagaattatttgatactcatttaatgcactgtatggcaaatacttggaccgtcttcaatcttctaacctaaaga |
11832054 |
T |
|
| Q |
116 |
gtatagtaaagaaaaataagacttgat-agtgaagaggacaacacaggagaggatctagatgcaaatatatgtagtatgcatgcgtgataggtggggtcg |
214 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11832053 |
gtatagtaaagaaaaataagacttgattagtgaagaggactacacaggagaggatccagatgcaaatatatgtagtatgcatgcgtgataggtggggtcg |
11831954 |
T |
|
| Q |
215 |
tggagtttgtgtgtcttcaccaaatcttgtggctatttttgtctttaaattcttctca |
272 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11831953 |
tggagtttgtgtgtcttcaccaaatcttgtggctatttttgtctttaaattcttctca |
11831896 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University