View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2168_low_21 (Length: 232)
Name: NF2168_low_21
Description: NF2168
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2168_low_21 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 181; Significance: 6e-98; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 181; E-Value: 6e-98
Query Start/End: Original strand, 18 - 214
Target Start/End: Complemental strand, 37581742 - 37581546
Alignment:
| Q |
18 |
attatttaacaaagagagcattttgaccgacatcattcaattgagggagtaattaactatttagtaaatttgggatccgaattgcccgacactcacaatt |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37581742 |
attatttaacaaagagagcattttaaccgacatcattcaattgagtgagtaattaactatttagtaaatttgggatccgaattgcccgacactcacaatt |
37581643 |
T |
 |
| Q |
118 |
aaggctctcagtttgttgaaaaaacaccagacagtcacgagtaattcaatttgatagctcggaaatgatgaattgtaccatccaggttagtcacccc |
214 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37581642 |
taggctctcagtttgttaaaaaaacaccagacagtcacgagtaattcaatttgatagctcggaaatgatgaattgtaccatccaggttagtcacccc |
37581546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University