View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21690_high_4 (Length: 350)
Name: NF21690_high_4
Description: NF21690
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21690_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 6e-68; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 6e-68
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 29986682 - 29986856
Alignment:
| Q |
1 |
agaacaggataagagaggttgaattatatgaat--gaggatgttgggttggggagtacatgttatttaagaaacaacctatcacatcatgacctctatgc |
98 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29986682 |
agaacaggataagagaggttgaattatatgaatatgaggatgttgggttggggagtacatgttatttaagaaacaacctatcacatcatgaccactatgc |
29986781 |
T |
|
| Q |
99 |
atcactgannnnnnncaacaaaatcatttaatgcatacttcacctcgtggggaatatggatatgtaattcgaagg |
173 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29986782 |
atcacttatttttttcaacaaaatcatttaatgcatacttcacctcgtggggaatatggatatgtaattggaagg |
29986856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 232 - 268
Target Start/End: Original strand, 29986915 - 29986951
Alignment:
| Q |
232 |
caaggttctatgtagatggatttataattgcaattac |
268 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29986915 |
caaggttctatgtagatggatttataattgcaattac |
29986951 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University