View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21692_high_10 (Length: 340)
Name: NF21692_high_10
Description: NF21692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21692_high_10 |
 | |
|
| [»] chr5 (2 HSPs) |
| |
|
Alignment Details
Target: chr5 (Bit Score: 145; Significance: 3e-76; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 192 - 340
Target Start/End: Original strand, 14257965 - 14258113
Alignment:
| Q |
192 |
tgggcaccaaacaaatccaagaaaaaatagttatgctacgtactgctgcaatgataagagcagaaaaagcagcgaaaataacccatctatctttcgccac |
291 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14257965 |
tgggcaccaaacaaatccaagaaaaaatagttatgctacatactgctgcaatgataagagcagaaaaagcagcgaaaataacccatctatctttcgccac |
14258064 |
T |
|
| Q |
292 |
aaggttccacattttacccaaagcataccaaacggtaacgggttgattg |
340 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14258065 |
aaggttccacattttacccaaagcataccaaacggtaacgggttgattg |
14258113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 16 - 90
Target Start/End: Original strand, 14257810 - 14257884
Alignment:
| Q |
16 |
atgagaatcaacaaacgcacattcccatgaaaaactttaatatcaccaccttgcgccgagaatatcgatgctgtc |
90 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14257810 |
atgagaatcagcaaacgcacattcccatgaaaaactttaatatcaccaccttgcgccgagaatatcgatgctgtc |
14257884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University