View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21692_high_11 (Length: 334)
Name: NF21692_high_11
Description: NF21692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21692_high_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 104; Significance: 8e-52; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 104; E-Value: 8e-52
Query Start/End: Original strand, 1 - 115
Target Start/End: Complemental strand, 44111766 - 44111651
Alignment:
| Q |
1 |
tcatttgaagtcatccatgatggaaggtttctcttggaagacatgatgacaataactacatgtaagatgataaagcaccaattttga-aaaacacccaag |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44111766 |
tcatttgaagtcatccatgatggaaggtttctcttggaagacatgatgacaataactacatgtaagatgataaagcaccaattttgaaaaaacacccaag |
44111667 |
T |
|
| Q |
100 |
ttccactacaaaaacc |
115 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
44111666 |
ttccactgcaaaaacc |
44111651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 294 - 328
Target Start/End: Complemental strand, 44111470 - 44111436
Alignment:
| Q |
294 |
cctgtttggttgattagtttctagttctttgtttc |
328 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
44111470 |
cctgtttggttgattagtttcttgttctttgtttc |
44111436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University