View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21692_high_19 (Length: 317)
Name: NF21692_high_19
Description: NF21692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21692_high_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 307; Significance: 1e-173; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 307; E-Value: 1e-173
Query Start/End: Original strand, 1 - 311
Target Start/End: Complemental strand, 4197653 - 4197343
Alignment:
| Q |
1 |
tagtaataaggggacaactttccatctttttgggaagactttgtttggctctctgggcctacttctagtaacatcttcaccactcttctcattgcaggcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4197653 |
tagtaataaggggacaactttccatctttttgggaagactttgtttggctctctgggcctacttctagtaacatcttcaccactcttctcattgcaggcc |
4197554 |
T |
 |
| Q |
101 |
ggttaattggaagaggactagtgcacattaggccaatattcaggaccttgcaaatttcttctttgtaaaaagaatcaagccttgagtcaagaacatggtc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4197553 |
ggttaattggaagaggactagtgcacattaggccaatattcaggaccttgcaaatttcttctttgtaaaaagaatcaagccttgagtcaagaacatggtc |
4197454 |
T |
 |
| Q |
201 |
aacacctttctgatccaaggtgttgcatgcccacataaccaagtctttttccccaaattcaggatctataggcttccttccggtgactaactcaaggata |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
4197453 |
aacacctttctgatccaaggtgttgcatgcccacataaccaagtctttttccccaaattcaggatctataggcttccttccagtgactaactcaaggata |
4197354 |
T |
 |
| Q |
301 |
acaacaccaaa |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
4197353 |
acaacaccaaa |
4197343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 95; Significance: 2e-46; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 1 - 311
Target Start/End: Original strand, 34921649 - 34921959
Alignment:
| Q |
1 |
tagtaataaggggacaactttccatctttttgggaagactttgtttggctctctgggcctacttctagtaacatcttcaccactcttctcattgcaggcc |
100 |
Q |
| |
|
|||||||||||||| || ||||||||||| | || || || ||||| ||||| ||||| ||| | ||||||||||| ||||||||||||| ||||| |
|
|
| T |
34921649 |
tagtaataaggggataattttccatctttcttggcaggtttcatttggttctctattcctacctcttgcaacatcttcactactcttctcattgaaggcc |
34921748 |
T |
 |
| Q |
101 |
ggttaattggaagaggactagtgcacattaggccaatattcaggaccttgcaaatttcttctttgtaaaaagaatcaagccttgagtcaagaacatggtc |
200 |
Q |
| |
|
|||| ||||||||||||||||| ||||| |||||||| || | ||||||||||||||||||||| || | |||||||||||||||||||| ||||| || |
|
|
| T |
34921749 |
ggttgattggaagaggactagtacacatgaggccaatgttgaaaaccttgcaaatttcttctttgaaacatgaatcaagccttgagtcaagtacatgatc |
34921848 |
T |
 |
| Q |
201 |
aacacctttctgatccaaggtgttgcatgcccacataaccaagtctttttccccaaattcaggatctataggcttccttccggtgactaactcaaggata |
300 |
Q |
| |
|
|| |||||||||||||| || |||| |||| ||||||| ||||| || || || |||||||| | ||| ||||| || ||||| ||||| ||| |
|
|
| T |
34921849 |
tacgcctttctgatccaatgtagtgcaaacccatttaaccaaatctttctctccgaactcaggatccacagggcgtcttccagtaactaattcaagtata |
34921948 |
T |
 |
| Q |
301 |
acaacaccaaa |
311 |
Q |
| |
|
||||||||||| |
|
|
| T |
34921949 |
acaacaccaaa |
34921959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University