View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21692_high_24 (Length: 311)
Name: NF21692_high_24
Description: NF21692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21692_high_24 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 258; Significance: 1e-144; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 258; E-Value: 1e-144
Query Start/End: Original strand, 9 - 311
Target Start/End: Complemental strand, 36763441 - 36763139
Alignment:
| Q |
9 |
agcagagaaagggattgaccaattccaccagcagcccccaatactgctactttgaatccaggtgccccacctttggctctgcagttagctctgtcaatta |
108 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36763441 |
agcaaagaaagggattgaccaattccaccagcagcccccaatactgctactttgaatccaggtgccccacctttggctctgcagttagctctgtcaatta |
36763342 |
T |
|
| Q |
109 |
caacatctcctccttcctgtcatnnnnnnncagacataacattcatacacaataattttaagataattactgtggttttgatataatttaggtctgccac |
208 |
Q |
| |
|
||||||| ||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36763341 |
caacatcacctccttcctgtcataaaaaaacagacataacattcatacacactaattttaagataattattgtggttttgatataatttaggtctgccac |
36763242 |
T |
|
| Q |
209 |
cgtcatttggacagaaatttaagctgcgaatcaaagttcttggttttgatgtctctgcaaccgcaacgctgccctaatttagaccgtgattatccataat |
308 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36763241 |
cgtcatttggaccgaaatttaggctgcgaatcaaagttcttggttttgatgtctctgcaaccgcaacgctgccctaatttagaccgtgattatccataat |
36763142 |
T |
|
| Q |
309 |
atc |
311 |
Q |
| |
|
||| |
|
|
| T |
36763141 |
atc |
36763139 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University