View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21692_high_27 (Length: 307)

Name: NF21692_high_27
Description: NF21692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21692_high_27
NF21692_high_27
[»] chr4 (1 HSPs)
chr4 (9-307)||(302439-302737)


Alignment Details
Target: chr4 (Bit Score: 291; Significance: 1e-163; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 291; E-Value: 1e-163
Query Start/End: Original strand, 9 - 307
Target Start/End: Original strand, 302439 - 302737
Alignment:
Q  9 atcacagaccacaatattggctttgggaagttcttcctgaaggaatattcatcatccacactgagagtagtcacagctggattatgaacaacagaagcac 108  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  302439 atcacagaccacaatattggctttgggaagttcttcctgaaggaatattcatcatccacactgagagtagtcacagctggattatgaacaacagaagcac 302538  T
Q  109 tatttaatttcattgaccctaaggactctaatggaccagaaaccttccttggagccccagaggaattcagcgggccagatgtaatcaaaccagttgttgg 208  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  302539 tatttaatttcattgaccctaaggactctaatggaccagaaaccttccttggagccccagaggaattcagcgggccagatgtaatcaaaccagttgttgg 302638  T
Q  209 aagaactggaggtattggacctgagttttggcgtgtgccaccacctgattgaggaccagaggacttcttaaccggttccccgtgtttattcaacggacc 307  Q
    ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  302639 aagaactggaggtattggacccgagttttggcgtgtgccaccacctgattgaggaccagaggacttcttaaccggttccccatgtttattcaacggacc 302737  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University