View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21692_high_29 (Length: 305)
Name: NF21692_high_29
Description: NF21692
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21692_high_29 |
 | |
|
| [»] chr2 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 118; Significance: 3e-60; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 152 - 305
Target Start/End: Complemental strand, 37483804 - 37483653
Alignment:
| Q |
152 |
gtattcggttcctgcaaattcaaaaactcttgttttaaatttgcagggactgagttgaaacnnnnnnncttacagggactaaaaccaaaacactctataa |
251 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
37483804 |
gtattcggttcctgcaaattcaaaaactcttgttttaaatttgcagggactgagttgaaacaaaaaaacttacagggactaaaaccaaaacactctataa |
37483705 |
T |
|
| Q |
252 |
ttgcgcagagacttaaattgtatttgtttttggtgtttgactgatagagtttat |
305 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37483704 |
tt--gcagagacttaaattgtatttgtttttggtgtttgattgatagagtttat |
37483653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 106; E-Value: 5e-53
Query Start/End: Original strand, 1 - 114
Target Start/End: Complemental strand, 37483955 - 37483843
Alignment:
| Q |
1 |
aatagtcctcacttacgcaaatctggaagtagacctgttgtttatgatcttggtattatttaagtttccgcaattatagtgttattcatgattctagttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
37483955 |
aatagtcctcacttacgcaaatctggaagtagacctgttgtttatgatcttggtattatttaagtttccg-aattatagtgttattcatgattctagttt |
37483857 |
T |
|
| Q |
101 |
ccgcaattatagtg |
114 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
37483856 |
ccgcaattatagtg |
37483843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University