View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21694_high_12 (Length: 318)
Name: NF21694_high_12
Description: NF21694
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21694_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 282; Significance: 1e-158; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 282; E-Value: 1e-158
Query Start/End: Original strand, 20 - 313
Target Start/End: Original strand, 36525810 - 36526103
Alignment:
| Q |
20 |
aaattgaactaacgactttcatgctgcaattgcagattagtttcactttcatcacatttcctacactagtatgtgcatacagcggacaagcagcatatct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36525810 |
aaattgaactaacgactttcatgctgcaattgcagattagtttcactttcatcacatttcctacactagtatgtgcatacagcggacaagcagcatatct |
36525909 |
T |
|
| Q |
120 |
cagaaagttccctgaacaaattgggagtaccttttataactcaacacctggtaagtttcttactgatgctagctctagattaatcttggttaaatgacaa |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36525910 |
cagaaagttccctgaacaaattgggagtaccttttataactcaacacctggtaagtttcttactgatgctagctctagattaatcttgattaaatgacaa |
36526009 |
T |
|
| Q |
220 |
atcaacatcaacatttcctaatcttggttaattttttcaatcacctgcagatctaatgttctggccaacatttgccgtgtccgtctgtggtgct |
313 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
36526010 |
atcaacatcaacatttcctaatcttggttaattttttcaatcacctgcagatctaatgttttggccaacatttgccgtgtccgtctgtgctgct |
36526103 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University