View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21696_high_1 (Length: 244)
Name: NF21696_high_1
Description: NF21696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21696_high_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 74; Significance: 5e-34; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 130 - 223
Target Start/End: Original strand, 36588578 - 36588671
Alignment:
| Q |
130 |
ccaggtgatgacgaggattacgccgaagattacggcgaggcagatcatggtggcgaagaaggcgcggaagaatgagcgggaagcgtaggagcga |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| ||||||||||| |||||||||||||| |||||| |
|
|
| T |
36588578 |
ccaggtgatgacgaggattacgccgaagataacggcgaggcagatcatagtggcgaagaaagcgcggaagaaggagcgggaagcgtatgagcga |
36588671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 7 - 45
Target Start/End: Original strand, 36588455 - 36588493
Alignment:
| Q |
7 |
attaccgttacggacgttaaaggtgagacgccacgtgcc |
45 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36588455 |
attaccgttgcggacgttaaaggtgagacgccacgtgcc |
36588493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University