View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21696_high_3 (Length: 360)
Name: NF21696_high_3
Description: NF21696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21696_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 11 - 265
Target Start/End: Original strand, 40225147 - 40225409
Alignment:
| Q |
11 |
cagagacgagcattggtggtggtggttgaagaggagtggttgtgggacctacaacggtaggtcgatcggtggtggtggttgttgttggaccagccgccat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40225147 |
cagagacgagcattggtggtggtggttgaagaggagtggttgtgggacctacaacggtaggtcgatcggtggtggtggttgttgttggaccagccgccat |
40225246 |
T |
|
| Q |
111 |
ggatggaa--------ggaagatgacaattgttgtttgtttgtgtgatccgagatgtcgggaagaacaatgacgttggttcgaaatctggctttagaatt |
202 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
40225247 |
ggatggaaggaaggaaggaagatgacaattgttgtttgtttgtgtgatccgagatgtcgggaagaacaatgatgttggttcgaaatctggctttagaatt |
40225346 |
T |
|
| Q |
203 |
gtcgcaggtgaaaacagaggtttgttgttgtttttagagagaggaaaaagggtttaggcttat |
265 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40225347 |
gtcgcaggtgaaaacagaggtttgttgttgtttttagagagaggaaaaagggtttaggcttat |
40225409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 116; Significance: 6e-59; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 38 - 215
Target Start/End: Original strand, 18106802 - 18106987
Alignment:
| Q |
38 |
gaagaggagtggttgtgggacctacaacggtaggtcgatcggtggtggtggttgttgttggaccagccgccatg----gatggaaggaagatgacaattg |
133 |
Q |
| |
|
||||||||| |||||||||||| |||| |||||||||||||| ||||||||||||||||||||||||||||||| || ||||||||||||||||||| |
|
|
| T |
18106802 |
gaagaggagcggttgtgggacccacaatggtaggtcgatcggaggtggtggttgttgttggaccagccgccatgaaaggaaggaaggaagatgacaattg |
18106901 |
T |
|
| Q |
134 |
ttgt----ttgtttgtgtgatccgagatgtcgggaagaacaatgacgttggttcgaaatctggctttagaattgtcgcaggtgaaa |
215 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||| |||||||||| ||||| ||||||||||||||||| |
|
|
| T |
18106902 |
ttgtttgtttgtttgtgtgatccgagatgtcgggaagaacaatgatgttgggtcgaaatctgtctttaaaattgtcgcaggtgaaa |
18106987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 46; Significance: 4e-17; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 46; E-Value: 4e-17
Query Start/End: Original strand, 37 - 98
Target Start/End: Complemental strand, 51588073 - 51588012
Alignment:
| Q |
37 |
tgaagaggagtggttgtgggacctacaacggtaggtcgatcggtggtggtggttgttgttgg |
98 |
Q |
| |
|
|||||||| | |||||||||||||||||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
51588073 |
tgaagaggtgaggttgtgggacctacaacggtaggtcgatcggtggtggtgtttgatgttgg |
51588012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 77 - 123
Target Start/End: Complemental strand, 35301477 - 35301432
Alignment:
| Q |
77 |
cggtggtggtggttgttgttggaccagccgccatggatggaaggaag |
123 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||| ||||||||| |
|
|
| T |
35301477 |
cggtggtggtggttgttgttgga-cagccgctatggaaggaaggaag |
35301432 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University