View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21696_high_4 (Length: 356)
Name: NF21696_high_4
Description: NF21696
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21696_high_4 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 77; Significance: 1e-35; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 77; E-Value: 1e-35
Query Start/End: Original strand, 208 - 344
Target Start/End: Original strand, 34779316 - 34779452
Alignment:
| Q |
208 |
taaacatgtatcatggtatagaaaatatttatcaaatgtgtcacaagtgcatgtgattaacttaaccatttaatttgcatcagagaacacggccctttga |
307 |
Q |
| |
|
|||||||| || ||| |||| ||||||||| ||||||||| |||||||||||||||| ||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
34779316 |
taaacatgcatggtggaataggaaatatttaccaaatgtgttgtaagtgcatgtgattaagttaaccatttatatcgcatcagagaacacggccctttga |
34779415 |
T |
|
| Q |
308 |
aattttgctgacaacttttggtaggactgacattctg |
344 |
Q |
| |
|
||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
34779416 |
aattttgctgacagcttttggtaggactgaaattctg |
34779452 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 290 - 347
Target Start/End: Complemental strand, 34682979 - 34682922
Alignment:
| Q |
290 |
gagaacacggccctttgaaattttgctgacaacttttggtaggactgacattctgtgg |
347 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
34682979 |
gagaacacagccctttgaaattttgctgacaacttttgataggactgagtttctgtgg |
34682922 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University