View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21698_high_11 (Length: 339)
Name: NF21698_high_11
Description: NF21698
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21698_high_11 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 255; Significance: 1e-142; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 255; E-Value: 1e-142
Query Start/End: Original strand, 1 - 339
Target Start/End: Complemental strand, 50655030 - 50654694
Alignment:
| Q |
1 |
atcatatcccaatattcat--gactgagaaagatagaaatcaatatcttagnnnnnnnnnnnnngttgagggaaaatcaatatcatagtgactgaatcat |
98 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50655030 |
atcatatcccaatattcatatgattgagaaagatagaaatcaatatcttagtttttttttt----ttgagggaaaatcaatatcatagtgactgaatcat |
50654935 |
T |
 |
| Q |
99 |
tttgcaattcataagtaacattcattagtctttttagcatagtataagtttcctcacttgaactgattggtttgctctcaaatgatacaatcttcttaat |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50654934 |
tttgcaattcataagtaacattcattagtctttttagcatagtataattttcctcacttgaactaattggtttgctctcaaatgatacaatcttcttaat |
50654835 |
T |
 |
| Q |
199 |
tacagattccaattttatgtggactaacagatccttagttcgggttaatggtttttgttgaactataggttttggattttatttggttgcataaattgtt |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50654834 |
tacagattccaattttatgtggactaacagatccttagttcgggttattggtttttgttgaactataggttttggattttatttggttgcataaattgtt |
50654735 |
T |
 |
| Q |
299 |
gtcttgaattcctgtttacccattatttgttattattgatg |
339 |
Q |
| |
|
||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
50654734 |
gtcgtgaattcctgttcacccattatttgttattactgatg |
50654694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University