View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2169_low_4 (Length: 295)
Name: NF2169_low_4
Description: NF2169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2169_low_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 81; Significance: 4e-38; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 1 - 85
Target Start/End: Original strand, 6434556 - 6434640
Alignment:
| Q |
1 |
taataaattatggttatgaagaattgtttaaaaaactaacacaatagtaatttaccgattgagattgagcaaagtaggaatgaat |
85 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6434556 |
taataaattatggttatgaagaattgtttaaaaaactaacacaatagtaatttaccaattgagattgagcaaagtaggaatgaat |
6434640 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 4e-38
Query Start/End: Original strand, 92 - 188
Target Start/End: Original strand, 6434748 - 6434844
Alignment:
| Q |
92 |
tttgggtaaaagaaagaagtaaatggaaatgaaaaaagggacagtcccccaacataaatatggagttttatttttcataatagcacaaagtcttttt |
188 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
6434748 |
tttgggtaaaacaaagaagtaaatggaaatgaaagaagggacagtcccccaacttaaatatggagttttatttttcaaaatagcacaaagtcttttt |
6434844 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University