View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2169_low_8 (Length: 250)
Name: NF2169_low_8
Description: NF2169
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2169_low_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 110; Significance: 2e-55; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 8 - 125
Target Start/End: Complemental strand, 43226325 - 43226208
Alignment:
| Q |
8 |
ttaagaaaactatgagtgccatgttcggtctttgttttgaataagcggggtagcttcttctccatcaaaagaggtaattcgagagttgttatgtttttgg |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
43226325 |
ttaagaaaactatgagtgccatgttcggtctttgttttgaataagcggggtagcttcttctccatcaaaagaggtaatttgagagttgttatatttttgg |
43226226 |
T |
|
| Q |
108 |
tcaaaaccaaaggaatat |
125 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
43226225 |
tcaaaaccaaaggaatat |
43226208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 1 - 93
Target Start/End: Complemental strand, 43242100 - 43242008
Alignment:
| Q |
1 |
ataagtattaagaaaactatgagtgccatgttcggtctttgttttgaataagcggggtagcttcttctccatcaaaagaggtaattcgagagt |
93 |
Q |
| |
|
||||||| |||||||| |||| || ||||| |||||||||||||||||||||||| ||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
43242100 |
ataagtaataagaaaattatggatgtcatgtccggtctttgttttgaataagcgggatagcttcttctgcatcaaaagaggtaatttgagagt |
43242008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 124 - 183
Target Start/End: Complemental strand, 43226124 - 43226065
Alignment:
| Q |
124 |
atccttacctttaaattagtggtttcataatttgatttagatacgaaacacttgtactag |
183 |
Q |
| |
|
|||||||||||||| |||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
43226124 |
atccttacctttaatttagtgctttcataatttgatttagatacgaaacacttttactag |
43226065 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University