View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21701_high_4 (Length: 375)
Name: NF21701_high_4
Description: NF21701
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21701_high_4 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 64 - 302
Target Start/End: Original strand, 51011043 - 51011277
Alignment:
| Q |
64 |
taaaaagtgtagtaacagatgaatgaatattgcaggcacaagtggaagtggctcagatagatgggaatgagtactttgtgaaggtgttttgtgagcatag |
163 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
51011043 |
taaaaagtgtagtaaca----catgaatattgcaggcacaagtggaagtggctcagatagatggtaatgagtactttgtgaaggtgttttgtgagcatag |
51011138 |
T |
|
| Q |
164 |
gcctggtggttttgtgaaattgatggatgctttcaacactttaggcatggatgtaatgcatgccacagtaaccagtcataagggtcttgtctcaaatgtt |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51011139 |
gcctggtggttttgtgaaattgatggatgctttcaacactttaggcatggatgtaatgcatgccacagtaaccagtcataagggtcttgtctcaaatgtt |
51011238 |
T |
|
| Q |
264 |
tttaaagttgaggtaaatataatataccttcaaaacatt |
302 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51011239 |
tttaaagttgaggtaaatataatataccttcaaaacatt |
51011277 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University