View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2170_high_2 (Length: 510)
Name: NF2170_high_2
Description: NF2170
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2170_high_2 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 106; Significance: 8e-53; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 106; E-Value: 8e-53
Query Start/End: Original strand, 193 - 374
Target Start/End: Original strand, 33549640 - 33549820
Alignment:
| Q |
193 |
taacttgcactttgtttttaatcacgttcatacaacgctatgtgtaatcttgattagtctttaatctgattatcaccatctctctcaaaaccgcaaaaag |
292 |
Q |
| |
|
||||||||| || || || ||||| |||||||||| |||||||||||||||||||||||||||| |||||||| | ||||||||||| |||||||||||| |
|
|
| T |
33549640 |
taacttgcatttcgtcttcaatcatgttcatacaatgctatgtgtaatcttgattagtctttaacctgattatgatcatctctctcataaccgcaaaaag |
33549739 |
T |
 |
| Q |
293 |
ttcccgcaaccctataacaggttgatatgatttgaccaaagtcatgatagggaggttgcaaatatccctaaacattgtgttc |
374 |
Q |
| |
|
||||| ||| ||||||| |||||||| ||||||||||||||| |||||||||||||||| | ||||||||||||| |||||| |
|
|
| T |
33549740 |
ttcccccaa-cctataataggttgatctgatttgaccaaagttatgatagggaggttgcgagtatccctaaacatcgtgttc |
33549820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 18 - 89
Target Start/End: Original strand, 33549516 - 33549587
Alignment:
| Q |
18 |
tgcttcctttgtccttgcatgctttcaagatattattgcttaaattgacaccaaaaccaaataaggaaaatg |
89 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
33549516 |
tgcttcctttgtccttgcatactttcaagatattattgcttaaattgataccaaaatcaaataaggaaaatg |
33549587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University