View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2171_high_4 (Length: 376)
Name: NF2171_high_4
Description: NF2171
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2171_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 272; Significance: 1e-152; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 272; E-Value: 1e-152
Query Start/End: Original strand, 66 - 365
Target Start/End: Original strand, 30099895 - 30100194
Alignment:
| Q |
66 |
gcaattaattaggatgagttggatgatgagagtgaggaggatgagtctcttggatataggaatttgatttctattcatgctgggaaaccaaaaggtaatg |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30099895 |
gcaattaattaggatgagttggatgatgagaatgaggaggatgagtctcttggatataggaatttgatttctattcatgctgggaaaccaaaaggtaatg |
30099994 |
T |
 |
| Q |
166 |
tggaacattggttgatggaacatgatcaagttaggcgtcttagcttgagtgagcaagttcttgaagatattgtcaaaactcaaggatctgaaatcgtcag |
265 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
30099995 |
tggaacactggttgacggaacatgatcaagttaggcgtcttagcttgagtgagcaagttcttgaagatatcgtcaaaactcaaggatctgaaattgtcag |
30100094 |
T |
 |
| Q |
266 |
gtgattttaaatatatttttggttgatcgtattgttgaacctcaataattttaatttagttagtcgactcgtaagagtgtgaaactctctcaacacctat |
365 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30100095 |
gtgattttaaatgtatttttggttgatcgtattgttgaacctcaataattttaatttagttaatcgactcgtaagagtgtgaaactctctcaacacctat |
30100194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University