View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2172_high_6 (Length: 250)
Name: NF2172_high_6
Description: NF2172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2172_high_6 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 16 - 250
Target Start/End: Original strand, 52486937 - 52487171
Alignment:
| Q |
16 |
cagaatgaacacattttaaaaaatttcccatgacagatggtaagtactaagtagcatttgatgtatataaaatagacaagacgccttaacttttgactta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52486937 |
cagaatgaacacattttaaaaaatttcccatgacagatggtaagtactaagtagcatttgatgtatataaaatagacaagacgccttaacttttgactta |
52487036 |
T |
 |
| Q |
116 |
ccttgaatttgcttttttcccgactgtctatgtatgccaaaagttcttcttgtctcattaaagcctcaaacaaagcctgtttaggaaattgaacatgcta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52487037 |
ccttgaatttgcttttttcccgactgtctatgtatgccaaaagttcttcttgtctcattaaagcctcaaacaaagcctgtttaggaaattgaacatgcta |
52487136 |
T |
 |
| Q |
216 |
gattacaaaacaatttttgaacaatcttgcgtact |
250 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
52487137 |
gattacaaaacaatttttgaacaatcttgcgtact |
52487171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 113 - 198
Target Start/End: Original strand, 7206960 - 7207045
Alignment:
| Q |
113 |
ttaccttgaatttgcttttttcccgactgtctatgtatgccaaaagttcttcttgtctcattaaagcctcaaacaaagcctgttta |
198 |
Q |
| |
|
|||||| |||||| ||| ||||| ||| |||||||||||||| |||||| |||||||| || ||||| || | |||||||||||| |
|
|
| T |
7206960 |
ttacctcgaattttcttctttcctgaccgtctatgtatgccataagttcctcttgtctgatcaaagcttcgtataaagcctgttta |
7207045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University