View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2172_low_10 (Length: 270)
Name: NF2172_low_10
Description: NF2172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2172_low_10 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 50 - 241
Target Start/End: Original strand, 53664980 - 53665171
Alignment:
| Q |
50 |
tttgaaggtacctagtgggaagacgatagaaatgcgcccaaagatcatcctcaaaaccgggagccataatctcaggaacattcaattccctaagtcgact |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53664980 |
tttgaaggtacctagtgggaagacgatagaaatgcgcccaaagatcatcctcaaaaccgggagccataatctcaggaacattcaattccctaagtcgact |
53665079 |
T |
|
| Q |
150 |
aagaactttgaggtaaacttcaatcttttgtttctgctttccattttgattccattcagaactgacaactttgatattacaacaactctctg |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
53665080 |
aagaactttgaggtaaacttcaatcttttgtttctgctttccattttgattccattcagaactgatagctttgatattgcaacaactctctg |
53665171 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University