View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2172_low_7 (Length: 316)
Name: NF2172_low_7
Description: NF2172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2172_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 10 - 285
Target Start/End: Complemental strand, 23339133 - 23338867
Alignment:
| Q |
10 |
atgaactcagcaagtgcagccttaagtgcatcagctttgccaaactcagaaggatttccaattgcaattctagaaatcggcattgttttatatttttcct |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
23339133 |
atgaactcagcaagtgcagccttaagtgcatcagctttgccaaactcagaaggatttccaattgcaattctagaaatcggcattgttttatattttttct |
23339034 |
T |
|
| Q |
110 |
tttctcaaagaaatttttcaagcttagaatagtacttttgataataacttgcacttcaagcttagttaatatttatgttggttagttttcttgctccaac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23339033 |
tttctcaaagaaatttttcaagcttagattagtacttttgataataacttgcacttcaagcttagttaatatttatgttggttagttttcttgctccaac |
23338934 |
T |
|
| Q |
210 |
tttaactaaaatgctgctatatatagtaagtaacatgacatgagtgtaagaacatggtgcagcatttcacgttgtt |
285 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |||||||||||||||| |||||||||||||| |
|
|
| T |
23338933 |
tttaactaaaatgctgctatatatagta---------acatgagagtaagaacatggtgcatcatttcacgttgtt |
23338867 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University