View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2173_high_13 (Length: 336)
Name: NF2173_high_13
Description: NF2173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2173_high_13 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 18 - 319
Target Start/End: Complemental strand, 7215130 - 7214821
Alignment:
| Q |
18 |
tttttatgtcaagttgtacaagtacaacgcttttaagacctttcacaacactaaacaaaaggttagttcacattttttcaaacatatggttgtttatttg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7215130 |
tttttatgtcaagttgtacaagtacaacgcttttaagacctttcacaacactaaacaaaaggttagttcacattttttcaaacatatggttgtttatttg |
7215031 |
T |
 |
| Q |
118 |
gnnnnnnnnngtgcaggttatttttt-agcgataattattctaacacaca-------catgttatactctttaaggaaatacattgagtttcgaagaaaa |
209 |
Q |
| |
|
| |||||||||||||||| |||||| |||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7215030 |
gtttttttttgtgcaggttatttttttagcgatcattattctaacacacaacacacacatgttatactctttaaggaaatacgttgagtttcgaagaaaa |
7214931 |
T |
 |
| Q |
210 |
ttgacgatttgaagacaaacactcatccgattacacatgaaatgccaaagtttaaagatttgaacggcggattccgaagttgggttttggatttatgagt |
309 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7214930 |
ttgacgatttgaagacaaacactcatccggttatacatgaaatgccaaagtttaaagatttgaacggcggattccgaagttgggttttggatttatgagt |
7214831 |
T |
 |
| Q |
310 |
ctctaatttg |
319 |
Q |
| |
|
|||||||||| |
|
|
| T |
7214830 |
ctctaatttg |
7214821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University