View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2173_high_23 (Length: 246)
Name: NF2173_high_23
Description: NF2173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2173_high_23 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 16 - 242
Target Start/End: Original strand, 44575471 - 44575697
Alignment:
| Q |
16 |
atcaagttcatccatcctggtggaaccttgaagtgagatccaatagacctatcagtttgtataacttgaagcacaccaaatgtgctctgctgatccatta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575471 |
atcaagttcatccatcctggtggaaccttgaagtgagatccaatagacctatcagtctgtataacttgaagcacaccaaatgtgctctgctgatccatta |
44575570 |
T |
|
| Q |
116 |
caatgaaacaacagattcctgtcacccatactggtagaattccaaacaagcatttcaagtgttccacttgttgcaaactacaaagtctccaaccattctt |
215 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44575571 |
caatgaaacaacaaattcctgtcacccatactggtagaattccaaacaagcatttcaagtgttccacttgttgcaaactacaaagtctccaaccattctt |
44575670 |
T |
|
| Q |
216 |
agcaattccttggttgttcatttcact |
242 |
Q |
| |
|
|||||||||||||||||||| |||||| |
|
|
| T |
44575671 |
agcaattccttggttgttcaattcact |
44575697 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University