View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2173_high_25 (Length: 238)
Name: NF2173_high_25
Description: NF2173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2173_high_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 47371845 - 47371614
Alignment:
| Q |
1 |
tgccatcgatttcgtatctgctcgtttttctattatccactcattgttttggcatcttgcaaatt---------gatatgatattagacaatcaagtaga |
91 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
47371845 |
tgccatcgatttcgtatctgttcgtttttctattatccactcattgttttggcatcttgcaaatttggcacattgatatgatattagacaatcaagtaga |
47371746 |
T |
 |
| Q |
92 |
aatatgtgcaaattcttgactatgcaaaatcaaaattatgtcaatttcagtggcatcataataatatacatagcttgaaattgaaacttcactgccatat |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47371745 |
aatatgtgcaaattcttgactatgcaaaatctaaattacgtcaatttcactggcatcataataatatacatagcttgaaattgaaacttcactgccatat |
47371646 |
T |
 |
| Q |
192 |
cagggaaaaataatagtcttattgaagattgt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47371645 |
cagggaaaaataatagtcttattgaagattgt |
47371614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University