View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2173_high_29 (Length: 214)
Name: NF2173_high_29
Description: NF2173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2173_high_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 71 - 177
Target Start/End: Original strand, 31609277 - 31609384
Alignment:
| Q |
71 |
ttgttgccctttgcttgaacaacaccagacagagtagtaatgattgtgctcacaacaaatac-aagtatatgatagttaatacaaaattttatcttgaag |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31609277 |
ttgttgccctttgcttgaacaacaccagacagagtagtaacgattgtactcacaacaaatacaaagtatatgatagttaatacaaaattttatcttgaag |
31609376 |
T |
 |
| Q |
170 |
aagtatca |
177 |
Q |
| |
|
|||||||| |
|
|
| T |
31609377 |
aagtatca |
31609384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 15 - 56
Target Start/End: Original strand, 31609180 - 31609221
Alignment:
| Q |
15 |
atgaaaatggtatgggcctggggtcaagaaaatacaggaggg |
56 |
Q |
| |
|
||||||||||| ||| ||| |||||||||||||||||||||| |
|
|
| T |
31609180 |
atgaaaatggtctggacctagggtcaagaaaatacaggaggg |
31609221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University