View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2173_high_3 (Length: 467)

Name: NF2173_high_3
Description: NF2173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2173_high_3
NF2173_high_3
[»] chr7 (1 HSPs)
chr7 (1-108)||(30355378-30355485)


Alignment Details
Target: chr7 (Bit Score: 104; Significance: 1e-51; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 1 - 108
Target Start/End: Complemental strand, 30355485 - 30355378
Alignment:
1 ctaatatggcagtttgatcaatgcacacactgaactaacctaaatgcttggacatgagatttagaacagtaaagtgaatgaacctgtactttgtctcaat 100  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30355485 ctaacatggcagtttgatcaatgcacacactgaactaacctaaatgcttggacatgagatttagaacagtaaagtgaatgaacctgtactttgtctcaat 30355386  T
101 accaatag 108  Q
    ||||||||    
30355385 accaatag 30355378  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University