View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2173_high_7 (Length: 387)
Name: NF2173_high_7
Description: NF2173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2173_high_7 |
 |  |
|
| [»] scaffold0140 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0140 (Bit Score: 91; Significance: 5e-44; HSPs: 1)
Name: scaffold0140
Description:
Target: scaffold0140; HSP #1
Raw Score: 91; E-Value: 5e-44
Query Start/End: Original strand, 286 - 376
Target Start/End: Complemental strand, 3038 - 2948
Alignment:
| Q |
286 |
ttttcttgtaattggccttaaaacaatgttgtctaagccttttggtatgatcttgcaattgcatatctggcatctcctccaccagcttcat |
376 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3038 |
ttttcttgtaattggccttaaaacaatgttgtctaagccttttggtatgatcttgcaattgcatatctggcatctcctccaccagcttcat |
2948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University