View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2173_low_15 (Length: 340)
Name: NF2173_low_15
Description: NF2173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2173_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 301; Significance: 1e-169; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 301; E-Value: 1e-169
Query Start/End: Original strand, 15 - 323
Target Start/End: Original strand, 4161153 - 4161461
Alignment:
| Q |
15 |
aatataactactgcttctcctcacatgtctgccactgctttgctgcaaaaagcatcacaaataggtgtaacgacagtgagtaaaacagaaccttgtagac |
114 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4161153 |
aatataaccactgcttctcctcacatgtctgccactgctttgctgcaaaaagcatcacaaataggtgtaacgacagtgagtaaaacagaaccttgtagac |
4161252 |
T |
 |
| Q |
115 |
cccacttaatgcaaactcacgtgccttcaggaatggttatgccttcacgtgaagaaataggaactactggtttttctcattgtttggcttcttatgggaa |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
4161253 |
cccacttaatgcaaactcacgtgccttcaggaatggttatgccttcacgtgaagaaataggaaccactggtttttctcattgtttggcttcttatgggaa |
4161352 |
T |
 |
| Q |
215 |
taaagctgcaataacttctgattgctttgaagaatcttcttctcttttgcatgatgtgatgtatggtagtgagagttcacattcacaatttgaagctgtt |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4161353 |
taaagctgcaataacttctgattgctttgaagaatcttcttctcttttgcatgatgtgatgtatggtagtgagagttcacattcacaatttgaagctgtt |
4161452 |
T |
 |
| Q |
315 |
actgctgct |
323 |
Q |
| |
|
||||||||| |
|
|
| T |
4161453 |
actgctgct |
4161461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University