View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2173_low_19 (Length: 311)
Name: NF2173_low_19
Description: NF2173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2173_low_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 3e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 86 - 292
Target Start/End: Original strand, 40021873 - 40022078
Alignment:
| Q |
86 |
ttatagaagaatcggttaggtgtgtacctaatcactgggcgatgaagagaattgcgaaaagttgaagcatttgaggaacagaaatcgaaaaaatccgaat |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40021873 |
ttatagaagaatcggttaggtgtgtacctaatcactgggcgatgaagagaattgcgaaaagttgaagcatttgaggaacagaaatcg-aaaaatccgaat |
40021971 |
T |
 |
| Q |
186 |
gaatttgcaaaacggcagagaaagagaaagaatgtgttctattcaacccacccaattgtgtgtcttcattttgtttt----acttaacctctgaaaatat |
281 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
40021972 |
gaatttgcaaaacggcagagaaagagaaagaatgtgttctattca----acccaattgtgtgtcttcattttgttttatcaacttaacctctgaaaatat |
40022067 |
T |
 |
| Q |
282 |
tctctaccctt |
292 |
Q |
| |
|
||| ||||||| |
|
|
| T |
40022068 |
tctataccctt |
40022078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University