View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2173_low_25 (Length: 252)
Name: NF2173_low_25
Description: NF2173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2173_low_25 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 76; Significance: 3e-35; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 126 - 242
Target Start/End: Complemental strand, 26257601 - 26257486
Alignment:
| Q |
126 |
aattaaatcaatcatataagttggttaatgcctgtcaccagttaaaatagatattgtgnnnnnnnncagaaaggctagatggctttaaaatcatttaagt |
225 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
26257601 |
aattaaatcaatcatataatttggttaatgcctgtcaccagttaaaatagatattgtg-aaaaaaacagaaaggctagattgctttaaaatcatttaagt |
26257503 |
T |
|
| Q |
226 |
tgttttttccgtctctg |
242 |
Q |
| |
|
||||||||||| ||||| |
|
|
| T |
26257502 |
tgttttttccgactctg |
26257486 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 1 - 77
Target Start/End: Complemental strand, 26257681 - 26257605
Alignment:
| Q |
1 |
ctaatattcaaatgaataccattagacattagttcaaaaccagaacacaaaaatgaattcataatgcggataagtga |
77 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26257681 |
ctaatattcaaataaataccattagacattagttcaaaaccagaacacaaaaatgaattcataatgtggataagtga |
26257605 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University