View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2173_low_26 (Length: 250)
Name: NF2173_low_26
Description: NF2173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2173_low_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 177; Significance: 2e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 177; E-Value: 2e-95
Query Start/End: Original strand, 21 - 240
Target Start/End: Complemental strand, 32773368 - 32773140
Alignment:
| Q |
21 |
ggccctgggtgtaaactacatgaactgtagttaagcatgaactaaaaaatttgaacttaaaacctat---------atgtcaagacaactctagaattat |
111 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
32773368 |
ggccgtgggtgtaaactacatgaactgtagttaagcatgaactaaaaaatttgaacttaaaacctatgtctttattatgtctagaaaactctagaattat |
32773269 |
T |
 |
| Q |
112 |
cgaagattcatattcgaacaataaatctgggtacaatttcttttgttcttcgaatttcttattatcaaataaggcaattaaggtgttaaaaaattcccaa |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||| |
|
|
| T |
32773268 |
cgaagattcatattcgaacaataaatctgggtacaatttcttttgttcttcgaatttcttattatcaaataaggcaattaggttgttaaaaaattcccaa |
32773169 |
T |
 |
| Q |
212 |
attttgttctttctttttggttgcctatg |
240 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
32773168 |
attttgttctttctttttggttgcctatg |
32773140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University