View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2173_low_33 (Length: 219)

Name: NF2173_low_33
Description: NF2173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2173_low_33
NF2173_low_33
[»] chr8 (3 HSPs)
chr8 (93-204)||(4276199-4276310)
chr8 (16-91)||(4276341-4276416)
chr8 (137-202)||(4273323-4273388)


Alignment Details
Target: chr8 (Bit Score: 112; Significance: 9e-57; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 93 - 204
Target Start/End: Complemental strand, 4276310 - 4276199
Alignment:
93 tatatcttaaagttaggatttgtaagcttttgcatctaaacatgttttttacattgaaatctagtgatcaattaacttttatgtaaatataaccggacat 192  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4276310 tatatcttaaagttaggatttgtaagcttttgcatctaaacatgttttttacattgaaatctagtgatcaattaacttttatgtaaatataaccggacat 4276211  T
193 aaaactctttca 204  Q
    ||||||||||||    
4276210 aaaactctttca 4276199  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 16 - 91
Target Start/End: Complemental strand, 4276416 - 4276341
Alignment:
16 caccatcttgattttagcagccataattgatcgtgaatgtgtaaaatttattttaacatgttttctttctcttgga 91  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4276416 caccatcttgaatttagcagccataattgatcgtgaatgtgtaaaatttattttaacatgttttctttctcttgga 4276341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 137 - 202
Target Start/End: Complemental strand, 4273388 - 4273323
Alignment:
137 ttttttacattgaaatctagtgatcaattaacttttatgtaaatataaccggacataaaactcttt 202  Q
    ||||||||| ||||||||| || ||||||||||||||||||| | |||||  ||||||||| ||||    
4273388 ttttttacaatgaaatctattgttcaattaacttttatgtaagtgtaacctaacataaaacacttt 4273323  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University