View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2173_low_33 (Length: 219)
Name: NF2173_low_33
Description: NF2173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2173_low_33 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 9e-57; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 93 - 204
Target Start/End: Complemental strand, 4276310 - 4276199
Alignment:
| Q |
93 |
tatatcttaaagttaggatttgtaagcttttgcatctaaacatgttttttacattgaaatctagtgatcaattaacttttatgtaaatataaccggacat |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4276310 |
tatatcttaaagttaggatttgtaagcttttgcatctaaacatgttttttacattgaaatctagtgatcaattaacttttatgtaaatataaccggacat |
4276211 |
T |
 |
| Q |
193 |
aaaactctttca |
204 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4276210 |
aaaactctttca |
4276199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 16 - 91
Target Start/End: Complemental strand, 4276416 - 4276341
Alignment:
| Q |
16 |
caccatcttgattttagcagccataattgatcgtgaatgtgtaaaatttattttaacatgttttctttctcttgga |
91 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4276416 |
caccatcttgaatttagcagccataattgatcgtgaatgtgtaaaatttattttaacatgttttctttctcttgga |
4276341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 137 - 202
Target Start/End: Complemental strand, 4273388 - 4273323
Alignment:
| Q |
137 |
ttttttacattgaaatctagtgatcaattaacttttatgtaaatataaccggacataaaactcttt |
202 |
Q |
| |
|
||||||||| ||||||||| || ||||||||||||||||||| | ||||| ||||||||| |||| |
|
|
| T |
4273388 |
ttttttacaatgaaatctattgttcaattaacttttatgtaagtgtaacctaacataaaacacttt |
4273323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University