View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2173_low_36 (Length: 214)

Name: NF2173_low_36
Description: NF2173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2173_low_36
NF2173_low_36
[»] chr1 (2 HSPs)
chr1 (71-177)||(31609277-31609384)
chr1 (15-56)||(31609180-31609221)


Alignment Details
Target: chr1 (Bit Score: 92; Significance: 7e-45; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 92; E-Value: 7e-45
Query Start/End: Original strand, 71 - 177
Target Start/End: Original strand, 31609277 - 31609384
Alignment:
71 ttgttgccctttgcttgaacaacaccagacagagtagtaatgattgtgctcacaacaaatac-aagtatatgatagttaatacaaaattttatcttgaag 169  Q
    |||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||    
31609277 ttgttgccctttgcttgaacaacaccagacagagtagtaacgattgtactcacaacaaatacaaagtatatgatagttaatacaaaattttatcttgaag 31609376  T
170 aagtatca 177  Q
    ||||||||    
31609377 aagtatca 31609384  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 15 - 56
Target Start/End: Original strand, 31609180 - 31609221
Alignment:
15 atgaaaatggtatgggcctggggtcaagaaaatacaggaggg 56  Q
    ||||||||||| ||| ||| ||||||||||||||||||||||    
31609180 atgaaaatggtctggacctagggtcaagaaaatacaggaggg 31609221  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University