View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2173_low_37 (Length: 201)
Name: NF2173_low_37
Description: NF2173
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2173_low_37 |
 | |
|
| [»] scaffold0031 (1 HSPs) |
| | |
|
| [»] scaffold0009 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 20 - 186
Target Start/End: Complemental strand, 47649826 - 47649660
Alignment:
| Q |
20 |
gaaggttgaagaaacttcttcagtttacttacaagctggatatggggacactgataaagatgtcattgcgaatattgcttttgaatcagttgtgggaggg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47649826 |
gaaggttgaagaaacttcttcagtttacttacaagctggatatggggacactgataaagatgtcattgcgaatattgcttttgaatcagttgtgggaggg |
47649727 |
T |
|
| Q |
120 |
cgattgggatattgtcgtggcttaggagctggaattaaacccctaaagggaaagtctatcacaggtt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
47649726 |
cgattgggatattgtcgtggcttaggagctggaattaaacccctaaagggaaagtctgtcacaggtt |
47649660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 23 - 171
Target Start/End: Complemental strand, 91981 - 91833
Alignment:
| Q |
23 |
ggttgaagaaacttcttcagtttacttacaagctggatatggggacactgataaagatgtcattgcgaatattgcttttgaatcagttgtgggagggcga |
122 |
Q |
| |
|
|||||||||| |||||||| | || || |||||||||||||| |||||||||||||| | ||| ||||||||||||| ||||||||||||||| |||| |
|
|
| T |
91981 |
ggttgaagaagcttcttcatatcacctagaagctggatatgggaacactgataaagatttaattatgaatattgcttttaaatcagttgtgggagagcga |
91882 |
T |
|
| Q |
123 |
ttgggatattgtcgtggcttaggagctggaattaaacccctaaagggaa |
171 |
Q |
| |
|
| |||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
91881 |
tcgggatattgtcgtggcttgggagctggaattaaaaccctaaagggaa |
91833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 47; Significance: 5e-18; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 20 - 74
Target Start/End: Original strand, 170995 - 171049
Alignment:
| Q |
20 |
gaaggttgaagaaacttcttcagtttacttacaagctggatatggggacactgat |
74 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
170995 |
gaaggttgaagaaacttcttcagttttcttacaagctggatatgaggacactgat |
171049 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 23 - 101
Target Start/End: Complemental strand, 30753951 - 30753873
Alignment:
| Q |
23 |
ggttgaagaaacttcttcagtttacttacaagctggatatggggacactgataaagatgtcattgcgaatattgctttt |
101 |
Q |
| |
|
|||||||||| ||||||| | ||||| | || || ||||||||||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
30753951 |
ggttgaagaagcttcttctgattactcagaaactagatatggggacaccgataaagatgtgattacgaatattgctttt |
30753873 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University