View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2174_low_14 (Length: 230)
Name: NF2174_low_14
Description: NF2174
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2174_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 16 - 214
Target Start/End: Complemental strand, 7383078 - 7382883
Alignment:
| Q |
16 |
aatattctgaccaaccaatgaatgagaaaacaagtgcatcgagcatgattaagtnnnnnnnnngttaaactagcaaagatatggaagaaggagtatacaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7383078 |
aatattctgaccaaccaatgaatgagaaaacaagtgcatcgagcatgatta-gtaaaaaaa--gttaaactagcaaagatatggaagaaggagtatacaa |
7382982 |
T |
 |
| Q |
116 |
acaaacaaattaaaatttatttcataagttattcaacaaacttatccaaactttggatgttctcaacttgctccgtgaatagagttgtagtactcctaa |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7382981 |
acaaacaaattaaaatttatttcataagttattcaacaaacttatccaaactttggatgttctcaacttgctccgtgaatagagttgtagtactcctaa |
7382883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University