View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2175_low_2 (Length: 260)
Name: NF2175_low_2
Description: NF2175
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2175_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 18 - 242
Target Start/End: Complemental strand, 14019412 - 14019201
Alignment:
| Q |
18 |
atgtcagttctctccttcatcacaatcatggtaaacttgttgacttgttgcatttaattgactgtgtaggatggtggagcactaattaattcaataaagt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14019412 |
atgtcagttctctccttcatcacaatcatggtaaacttgttgacttgttgcatttaattgactgtgtaggatggtggagcactaattaattcaataaagt |
14019313 |
T |
 |
| Q |
118 |
tataaagtagtagtaatacatgtaactagctagtaatccaagctagtaatcagtggatttcgatttcttggtagtatagtgtttggattgaaataggatg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14019312 |
tataaagtagtagtaatacatgtaactagctagt-------------aatcagtggatttcgatttcttggtagtatagtgtttggattgaaataggatg |
14019226 |
T |
 |
| Q |
218 |
atctatattccaaatttgtatttaa |
242 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
14019225 |
atctatattccaaatttgtatttaa |
14019201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University