View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2176_high_106 (Length: 216)
Name: NF2176_high_106
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2176_high_106 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 216
Target Start/End: Original strand, 39634813 - 39635028
Alignment:
| Q |
1 |
tggtgtattaaggggtcaatattggatgagatgattaggtataagcatgtgtttataaataagggttgtctccaccttgcaagtaagttcgtaaggatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39634813 |
tggtgtattaaggggtcaatattggatgagatgattaggtctaagcatgtgtttataaataagggttgtctccaccttgcaagtaagttcgtaaggatga |
39634912 |
T |
 |
| Q |
101 |
gttccacaaaactcaaattgaattcgagtggttaatgaactttgattaaggacgggtcatttgaaagaacccaaatatgaatcttggttggaataattga |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
39634913 |
attagacaaaactcaaattgaattcgagtggttaatgaactttgattaaggacaggtcatttgaaagaatccaaatatgaatcttggttggaataattaa |
39635012 |
T |
 |
| Q |
201 |
gtggttaatgaacttt |
216 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
39635013 |
gtggttaatgaacttt |
39635028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 127 - 198
Target Start/End: Original strand, 39635012 - 39635083
Alignment:
| Q |
127 |
agtggttaatgaactttgattaaggacgggtcatttgaaagaacccaaatatgaatcttggttggaataatt |
198 |
Q |
| |
|
||||||||||||||||| |||||||||||||| | |||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
39635012 |
agtggttaatgaactttaattaaggacgggtcgtatgaaagaacctaaatatgaatcttggctggaataatt |
39635083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University