View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2176_high_39 (Length: 394)
Name: NF2176_high_39
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2176_high_39 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 78 - 380
Target Start/End: Original strand, 26945391 - 26945693
Alignment:
| Q |
78 |
gtgaagaattgaagatgacaccttagtgaattaatcaattaaattaaccgcgaagggaaaaaagcaagtttctgaaaaatccatttttctcttttatttc |
177 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| | |||| |
|
|
| T |
26945391 |
gtgaagaattgaagatgacaccttactgaattaatcaattaaattaaccgcgaagggaaaaaagcaagtgtctgaaaaatccatttttctcttctctttc |
26945490 |
T |
 |
| Q |
178 |
actctcactctacaattaannnnnnngggtcaaacaaatgggtggcggacacgacgacaccaccaccgaaagcagcgatttcacctccgaagacgaaggc |
277 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26945491 |
actctcactctacaattaatttttttgggtcaaacaaatgggtggcggacacgacgacaccaccaccgaaagcagcgatttcacctccgaagacgaaggc |
26945590 |
T |
 |
| Q |
278 |
acagaagattaccgacgcggtggctaccacgccgttcgaatcggcgacactttcagctccggtcgttatgtcgttcagagcaagcttggttggggtcatt |
377 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
26945591 |
acagaagattaccgacgcggtggctaccacgccgttcgaatcggcgacactttcagctccggtcgttatgtcgttcagagcaagcttggttggggccatt |
26945690 |
T |
 |
| Q |
378 |
tct |
380 |
Q |
| |
|
||| |
|
|
| T |
26945691 |
tct |
26945693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University