View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2176_high_47 (Length: 363)
Name: NF2176_high_47
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2176_high_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 106; Significance: 6e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 76 - 232
Target Start/End: Complemental strand, 2157616 - 2157455
Alignment:
| Q |
76 |
ttaatgtaacactttagccatgaaattgaaaagaaagctgtgcaaaatcactttagagtaccatacatattcttatatcnnnnnnnn-----gacaaaat |
170 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
2157616 |
ttaatgtatcactttagccatgaaattgtaaagaaagctgtgcaaaatcactttggagtaccatacatattcttatatctttttttttttttgacaaaat |
2157517 |
T |
 |
| Q |
171 |
attcttatatcttctagtagtatttatttttgcatggaaagataagcaaatttagaagccgg |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2157516 |
attcttatatcttctagtagtatttatttttgcatggaaagataagcaaatttagaagccgg |
2157455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000009
Query Start/End: Original strand, 13 - 54
Target Start/End: Complemental strand, 2157674 - 2157633
Alignment:
| Q |
13 |
aatattcaaaaaacataacgaataaataattatagttaatgt |
54 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2157674 |
aatattcaaaaaacataacgaataaataattatagttaatgt |
2157633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University