View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2176_high_70 (Length: 300)
Name: NF2176_high_70
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2176_high_70 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 266; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 266; E-Value: 1e-148
Query Start/End: Original strand, 1 - 286
Target Start/End: Complemental strand, 50420820 - 50420535
Alignment:
| Q |
1 |
ccgctcattgtagtctttgtcgactcaagggatcattagtctctacaatttcgagtagaggatacttgggtataccataaaattgttttttcttagggta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
50420820 |
ccgctcattgtagtctttgtcgactcaagggatcattagtctctacaatttccagtagaggatacttgggtataccaaaaaattgttttttcttagggta |
50420721 |
T |
 |
| Q |
101 |
gtttgataaatgtcatactctagaaaccctgaacctgaacattttaaacctagaagtgcaataaaaatttgtcagtactgtattttcaccggcaaaaagg |
200 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50420720 |
gtttgataaatgccatactctagaaaccctgaacctgaacatgttaaacctagaagtgcaataaaaatttgtcagtactgtattttcaccggcaaaaagg |
50420621 |
T |
 |
| Q |
201 |
atatttttcacatcatcaacatgggtggaaaagtgagatatgaagccataaagaaaagacagaaaagttatagatctatgatgatg |
286 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50420620 |
atatttttcacatcatcgacatgggtggaaaagtgagatatgaagccataaagaaaagacagaaaagttatagatctatgatgatg |
50420535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University