View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2176_high_79 (Length: 260)
Name: NF2176_high_79
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2176_high_79 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 153; Significance: 4e-81; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 18 - 251
Target Start/End: Original strand, 26263000 - 26263233
Alignment:
| Q |
18 |
aaattatggatatctttgagattttgcgtcaccgatgggaaagaaactagagaaaaaaccccaccatcgaattagatggaagcatttatcaaacaaaaca |
117 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| | |
|
|
| T |
26263000 |
aaattatggatatctttgagattttgtgtcaccgatgtgaaagaaactagagaaaaaaccccaccatcgaattagatggatgcatttatcaaacaaaata |
26263099 |
T |
 |
| Q |
118 |
gagagagctttatacaaagcaagggaaagaaaaggcnnnnnnnnnnnntttaaggtcaacatatttccatgcnnnnnnngtcccctttagattgtttgtt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |||||| || |
|
|
| T |
26263100 |
gagagagctttatacaaagcaagggaaagaaaaggcaaaaaataaaaatttaaggtcaacatatttccatgctttttttgtcccctttaggttgtttctt |
26263199 |
T |
 |
| Q |
218 |
ttctcacctcatgagtttcttctgtatcctatgc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
26263200 |
ttctcacctcatgagtttcttctgtatcctatgc |
26263233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University