View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2176_high_83 (Length: 250)
Name: NF2176_high_83
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2176_high_83 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 169; Significance: 1e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 1 - 238
Target Start/End: Original strand, 32360811 - 32361053
Alignment:
| Q |
1 |
taactgtgtttagaaatttatacttttcaatcacgcccaattcttgtacttattatgtcattaccaattgcgtatttgaataggtgcatgttaagataag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32360811 |
taactgtgtttagaaatttatacttttcaatcacgcccaattcttgtacttattatgtcattaccaattgcgtatttgaataggtgcatgttaagataag |
32360910 |
T |
 |
| Q |
101 |
ctcatacaatggttttcaggattactggctnnnnnnnnttgcattaccgaaagtttacacata----tacgtatacactatacttaaaagatctttaatt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
32360911 |
ctcatacaatggttttcaggattactggctaaaaaaaattgcattaccgaaagtttacacatatacgtacgtatacactatacttaaaagatctttaatt |
32361010 |
T |
 |
| Q |
197 |
taaatat-tnnnnnnntgaggaacatgttgggttttgcgtctg |
238 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |
|
|
| T |
32361011 |
taaatataaaaaaaaatgaggaacatgttgggttttgcgtctg |
32361053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University