View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2176_high_95 (Length: 234)
Name: NF2176_high_95
Description: NF2176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2176_high_95 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 86 - 121
Target Start/End: Original strand, 19583227 - 19583262
Alignment:
| Q |
86 |
gtgtgtgagagcttcaattaactgactaacggtatt |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
19583227 |
gtgtgtgagagcttcaattaactgactaacggtatt |
19583262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 45 - 121
Target Start/End: Complemental strand, 19590387 - 19590311
Alignment:
| Q |
45 |
atttctcaagagttcaatggtatgatcttggattagat---acagtgtgtgagagcttcaattaactgactaacggtatt |
121 |
Q |
| |
|
||||||||||| ||||||||||| |||||||| ||| | ||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
19590387 |
atttctcaagaattcaatggtat---cttggatttgattatatagtgtgtcagagcttcaataaactgactaacggtatt |
19590311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University